http://repub.eur.nl/res/aut/2555/ List of Publications en http://repub.eur.nl/static-eur/img/logo.png http://repub.eur.nl http://repub.eur.nl/res/pub/30885/ 2011-09-23T00:00:00Z Fusion between androgen-regulated TMPRSS2 and ETS transcription factor gene ERG is the most frequent genetic alteration that occurs in 40-70% of prostate cancers. Not only ERG but also other ETS transcription factor genes are involved in gene fusions. ETV1, ETV4, and ETV5 have all several fusion partners. One common feature shared by the majority of these partners is androgen-regulated expression. Despite its high frequency, the biological and molecular effects of ETS gene fusion in prostate cancer development and progression are unknown. In this chapter quantitative polymerase chain reaction (Q-PCR) is used for detection and further studying the incidence and properties of these fusion transcripts. The focus is on the expression of TMPRSS2-ERG transcripts in clinical prostate samples. Androgen regulation of TMPRSS2 is measured in commonly used LNCaP prostate cancer cells grown with and without the synthetic androgen R1881. Furthermore, combining Q-PCR with 5′ RLM-RACE and sequencing are described for the identification of novel ETS fusion partners. http://repub.eur.nl/res/pub/26572/ 2011-07-01T00:00:00Z Chromosomal rearrangements that result in high expression levels of the ETS-related gene (ERG) present in approximately 50% of prostate cancer (PCa) patients, making this one of the most common oncogenic alterations in PCa. However, ERG overexpression at the protein level has not been rigorously evaluated in Japanese PCa patients. In this study, we evaluated ERG expression using antibody-based detection in 230 prostate specimens in a Japanese PCa cohort. Overall, we identified 20.1% ERG-positive PCa cases. ERG was not detected in benign glands. The specificity of ERG staining for detecting PCa was almost 100%; all of the ERG-positive samples were also diagnosed as PCa. The expression level of the ERG protein correlated with clinicopathological variables, including grade (P= 0.038), stage (P= 0.005), and metastatic status (P= 0.014). No correlation was observed with age (P= 0.196) or with preoperative prostate-specific antigen level (P= 0.322). Although the frequency of ERG-positive cases in Japanese PCa patients (20.1%) was lower than that reported in a PCa cohort in Western countries (approximately 50%), our study demonstrates that the clinical utility of ERG detection at the protein level can serve as an ancillary tool for diagnosing PCa in the Japanese population. © 2011 The Authors. Pathology International http://repub.eur.nl/res/pub/33848/ 2011-07-01T00:00:00Z http://repub.eur.nl/res/pub/33779/ 2011-05-01T00:00:00Z BACKGROUND FGFR3 mutations are associated with a good clinical disease course in bladder tumors. Currently, prognostic markers to stratify prostate cancer (PCa) patients for conservative management are lacking. Conflicting results have been found on the presence of FGFR3 mutations in PCa. Our objective was to determine the prevalence of FGFR3 mutations in a subset of prostate tumors. Next, determine the prevalence of FGFR3 mutations in PCa patients with coexistent tumors in other tissues. METHODS Primary and locally advanced prostate tumors (n = 132) were collected at our medical center. From the 132 PCa patients, 28 (21%) were diagnosed with coexistent primary tumors (bladder, skin, pancreas, renal cell, gastric, colon, hepatic, and lung). Tumors were analyzed by FGFR3 mutation analysis on exon 7, 10, and 15, known to harbor the most frequent mutations. RESULTS The prevalence of FGFR3 mutations in patients with only PCa was 0%. Most PCa patients presented with coexistent bladder (n = 12) and bladder and skin tumors (n = 7). Other coexistent tumors in PCa patients included: bladder and pancreatic cancer (n = 1); bladder and renal cell carcinoma (n = 1); bladder and gastric carcinoma (n = 1); skin cancer (n = 1); colon cancer (n = 3); hepatic carcinoma (n = 1); and lung cancer (n = 1). FGFR3 mutations were detected in 9/15 (60%) analyzed bladder tumors. CONCLUSIONS FGFR3 mutations were absent in the investigated prostate tumors, suggesting a minor role of these mutations in tumorigenesis. Hence, FGFR3 mutation analysis is not suitable to select patients for conservative management. Interestingly, if a prostate tumor coincided with other tumors these were mostly bladder and skin. http://repub.eur.nl/res/pub/23994/ 2011-02-07T00:00:00Z ETV1 is overexpressed in a subset of clinical prostate cancers as a fusion transcript with many different partners. However, ETV1 can also be overexpressed as a full-length transcript. Full-length ETV1 protein functions differently from truncated ETV1 produced by fusion genes. In this study we describe the genetic background of full-length ETV1 overexpression and the biological properties of different full-length ETV1 isoforms in prostate cancer. Break-apart FISH showed in five out of six patient samples with overexpression of full-length ETV1 a genomic rearrangement of the gene, indicating frequent translocation. We were able to study the rearrangements in more detail in two tumors. In the first tumor 59′-RACE on cDNA showed linkage of the complete ETV1 transcript to the first exon of a prostate-specific two exon ncRNA gene that maps on chromosome 14 (EST14). This resulted in the expression of both full-length ETV1 transcripts and EST14-ETV1 fusion transcripts. In chromosome spreads of a xenograft derived from the second prostate cancer we observed a complex ETV1 translocation involving a chromosome 7 fragment that harbors ETV1 and fragments of chromosomes 4 and 10. Further studies revealed the overexpression of several different full-length transcripts, giving rise to four protein isoforms with different N-terminal regions. Even the shortest isoform synthesized by full-length ETV1 stimulated in vitro anchorage-independent growth of PNT2C2 prostate cells. This contrasts the lack of activity of even shorter N-truncated ETV1 produced by fusion transcripts. Our findings that in clinical prostate cancer overexpression of full-length ETV1 is due to genomic rearrangements involving different chromosomes and the identification of a shortened biologically active ETV1 isoform are highly relevant for understanding the mechanism of ETV1 function in prostate cancer. http://repub.eur.nl/res/pub/27945/ 2010-05-01T00:00:00Z Background: Fusion of the androgen-regulated gene transmembrane protease, serine 2, TMPRSS2, to the v-ets erythroblastosis virus E26 oncogene homolog (avian), ERG, of the erythroblast transformation-specific (ETS) family is the most common genetic alteration in prostate cancer (PCa). Objective: To determine whether expression of androgen-regulated TMPRSS2-ERG predicts response to endocrine treatment in hormone-naïve, node-positive PCa. Design, setting, and participants: Eighty-five patients with histologically confirmed, node-positive PCa who were without treatment at the moment of lymph node dissection were analysed. RNA was isolated from the paraffin-embedded lymph node metastases and complementary DNA (cDNA) was made. The quality of cDNA was tested by polymerase chain reaction (PCR) analysis of the expression of the housekeeping gene hydroxymethylbilane synthase, HMBS (formerly PBGD). TMPRSS2-ERG expression was analysed by PCR using a forward primer in TMPRSS2 exon 1 and a reverse primer in ERG exon 4. Measurements: The primary end point was time from start of endocrine therapy to the occurrence of three consecutive rises in prostate-specific antigen (PSA) that were at least 2 wk apart and resulted in two 50% increases over the PSA nadir. Secondary end points were time to PSA nadir after start of endocrine treatment and cancer-specific and overall survival. Results and limitations: TMPRSS2-ERG was expressed in 59% of the 71 patients who could be analysed. Median duration of response to endocrine therapy was 20.9 mo versus 24.1 mo for gene fusion-positive versus gene fusion-negative patients (95% confidence intervals: 18.6-23.1 vs 18.9-29.4, p = 0.70). Furthermore, no significant differences were seen between the two groups for the secondary end points. Conclusions: Expression of TMPRSS2-ERG is frequent in lymph node metastases of patients with untreated PCa; however, expression of this androgen-regulated fusion gene did not correspond with duration of response to endocrine therapy. Our results suggest that expression of TMPRSS2-ERG is not a candidate marker to select for metastatic PCa patients who will benefit more from endocrine treatment. http://repub.eur.nl/res/pub/24935/ 2009-12-01T00:00:00Z Mutations in the androgen receptor (AR) gene, rendering the AR protein partially or completely inactive, cause androgen insensitivity syndrome, which is a form of a 46,XY disorder of sex development (DSD). We present 3 novel AR variants found in a cohort of Indonesian DSD patients: p.I603N, p.P671S, and p.Q738R. The aim of this study was to determine the possible pathogenic nature of these newly found unclassified variants. To investigate the effect of these variants on AR function, we studied their impact on transcription activation, AR ligand-binding domain interaction with an FxxLF motif containing peptide, AR subcellular localization, and AR nuclear dynamics and DNA-binding. AR-I603N had completely lost its transcriptional activity due to disturbed DNA-binding capacity and did not show the 114-kDa hyperphosphorylated AR protein band normally detectable after hormone binding. The patient with AR-I603N displays a partial androgen insensitivity syndrome phenotype, which is explained by somatic mosaicism. A strongly reduced transcriptional activity was observed for AR-Q738R, together with diminished interaction with an FxxLF motif containing peptide. AR-P671S also showed reduced transactivation ability, but no change in DNA- or FxxLF-binding capacity and interferes with transcriptional activity for as yet unclear reasons. http://repub.eur.nl/res/pub/25269/ 2009-10-15T00:00:00Z Purpose: To gain insight in the mechanism and clinical relevance of TMPRSS2-ERG expression in prostate cancer,wedetermined the specific characteristics of fusion transcripts starting at TMPRSS2 exon 1 and at a more upstream and less characterized exon 0. Experimental Design: We used quantitative PCR analysis to investigate expression of wild-type TMPRSS2(exon 0) and TMPRSS2(exon 1) and of ERG fusion transcripts. Expression was tested in normal tissue samples, in prostate cancer cell lines and xenografts, and in fresh-frozen clinical prostate cancer samples (primary tumors and recurrences). Expression in clinical samples was correlated with disease progression. Results: TMPRSS2(exon 0) and TMPRSS2(exon 1) transcripts were similarly androgen regulated in prostate cancer cell lines, but the expression levels ofTMPRSS2(exon 1)were much higher. Comparison of expression in different tissues showed TMPRSS2(exon 0) expression to be much more prostate specific. In androgen receptor-positive prostate cancer xenografts, TMPRSS2(exon 1) transcripts were expressed at similar levels, but TMPRSS2(exon 0) transcripts were expressed at very variable levels. The same phenomenon was observed for TMPRSS2-ERG fusion transcripts. In clinical prostate cancers, the expression of TMPRSS2(exon 0)-ERG was even more variable. Expression of TMPRSS2 (exon 0)-ERG transcripts was detected in 55% (24 of 44) of gene fusion-positive primary tumors but only in 15% (4 of 27) of gene fusion-positive recurrences and at much lower levels. Furthermore, in primary tumors, expression of TMPRSS2(exon 0)-ERG transcripts was an independent predictor of biochemical progression-free survival. Conclusion: The expression of TMPRSS2(exon 0)-ERG fusion transcripts in prostate cancer is associated with a less-aggressive biological behavior. http://repub.eur.nl/res/pub/16597/ 2009-03-01T00:00:00Z Phaeochromocytomas (PCCs) are neuro-endocrine tumours of the adrenal medulla that are usually benign, but approximately 10% of patients develop metastases. Malignant PCCs can only be diagnosed with certainty if metastases are present. Here we describe adrenal tumours generated in a Pten conditional knock-out (KO) mouse model. We characterized the molecular alterations in these tumours and compared them with human PCC. Thirty-two of 41 (78%) male Psa-Cre;Pten-loxP/loxP mice presented adrenal tumours that were shown to be PCC by histology and by immunohistochemical staining for enzymes in the catecholamine biosynthetic pathway. In 6 of 17 investigated mice, histological and immunohistochemical evidence was obtained for the presence of PCC lung metastases. Array comparative genomic hybridization (CGH) analysis of the primary tumours showed loss of chromosomes 6 and 19, which are syntenic to human 3p and 11q. Another frequent alteration found was gain of chromosome 15, which is syntenic to human chromosome 5. The molecular aberrations in the mouse model corresponded to the alterations found in a subtype of human PCC, suggesting that the PCC of the Pten KO mice might be representative of human PCC. The mouse model should allow further studies into the pathogenesis of human malignant PCCs and into therapeutic strategies for these tumours. http://repub.eur.nl/res/pub/29084/ 2008-12-01T00:00:00Z http://repub.eur.nl/res/pub/29654/ 2008-09-24T00:00:00Z A novel mutation F826L located within the ligand binding domain (LBD) of the human androgen receptor (AR) was investigated. This mutation was found in a boy with severe penoscrotal hypospadias (classified as 46,XY DSD). The AR mutant F826L appeared to be indistinguishable from the wild-type AR, with respect to ligand binding affinity, transcriptional activation of MMTV-luciferase and ARE2-TATA-luciferase reporter genes, protein level in genital skin fibroblasts (GSFs), and sub-cellular distribution in transfected cells. However, an at least two-fold higher NH2-/COOH-terminal domain interaction was found in luciferase and GST pull-down assays. A two-fold increase was also observed for TIF2 (transcription intermediary factor 2) co-activation of the AR F826L COOH-terminal domain. This increase could not be explained by a higher stability of the mutant protein, which was within wild-type range. Repression of transactivation by the nuclear receptor co-repressor (N-CoR) was not affected by the AR F826L mutation. The observed properties of AR F826L would be in agreement with an increased activity rather than with a partial defective AR transcriptional activation. It is concluded that the penoscrotal hypospadias in the present case is caused by an as yet unknown mechanism, which still may involve the mutant AR. http://repub.eur.nl/res/pub/14456/ 2008-09-15T00:00:00Z In this study, we describe the properties of novel ETV1 fusion genes, encoding N-truncated ETV1 (dETV1), and of full-length ETV1, overexpressed in clinical prostate cancer. We detected overexpression of novel ETV1 fusion genes or of full-length ETV1 in 10% of prostate cancers. Novel ETV1 fusion partners included FOXP1, an EST (EST14), and an endogenous retroviral repeat sequence (HERVK17). Like TMPRSS2, EST14 and HERVK17 were prostate-specific and androgen-regulated expressed. This unique expression pattern of most ETV1 fusion partners seems an important determinant in prostate cancer development. In transient reporter assays, full-length ETV1 was a strong transactivator, whereas dETV1 was not. However, several of the biological properties of dETV1 and full-length ETV1 were identical. On stable overexpression, both induced migration and invasion of immortalized nontumorigenic PNT2C2 prostate epithelial cells. In contrast to dETV1, full-length ETV1 also induced anchorage- independent growth of these cells. PN T2C2 cells stably transfected with dETV1 or full-length ETV1 expression constructs showed small differences in induced expression of target genes. Many genes involved in tumor invasion/metastasis, including uPA/uPAR and MMPs, were up-regulated in both cell types. Integrin β3 (ITGB3) was clearly up-regulated by full-length ETV1 but much less by dETV1. Based on the present data and on previous findings, a novel concept of the role of dETV1 and of full-length ETV1 overexpression in prostate cancer is proposed. http://repub.eur.nl/res/pub/35945/ 2007-06-01T00:00:00Z BACKGROUND. Specificity of transgene expression is important for safety during gene therapeutical applications. For prostate cancer, transcriptional targeting has been applied but was hampered by loss of specificity and low activity. We constructed a small chimeric promoter for high and prostate-specific transgene expression from adenoviral vectors. METHODS. A chimeric promoter, composed of the prostate-specific antigen (PSA) enhancer and the rat probasin promoter, was cloned into an adenoviral vector and its activity was compared to vectors containing conventional prostate-specific promoters and the constitutive Cytomegalovirus (CMV) promoter in in vitro and in vivo prostate cancer models. RESULTS. The chimeric PSA-probasin promoter was the most active prostate-specific promoter reaching up to 20% of CMV promoter activity while maintaining prostate-specificity. CONCLUSIONS. The chimeric PSA-probasin promoter is a small promoter that can be utilized in viral vectors for high prostate-specific transgene expression. http://repub.eur.nl/res/pub/13863/ 2005-07-01T00:00:00Z The PTEN tumor suppressor gene is frequently inactivated in human tumors, including prostate cancer. Based on the Cre/loxP system, we generated a novel mouse prostate cancer model by targeted inactivation of the Pten gene. In this model, Cre recombinase was expressed under the control of the prostate-specific antigen (PSA) promoter. Conditional biallelic and monoallelic Pten knock-out mice were viable and Pten recombination was prostate-specific. Mouse cohorts were systematically characterized at 4 to 5, 7 to 9, and 10 to 14 months. A slightly increased proliferation rate of epithelial cells was observed in all prostate lobes of monoallelic Pten knock-out mice (PSA-Cre;Pten-loxP/+), but minimal pathologic changes were detected. All homozygous knock-out mice (PSA-Cre;Pten-loxP/loxP) showed an increased size of the luminal epithelial cells, large areas of hyperplasia, focal prostate intraepithelial neoplasia lesions and an increased prostate weight at 4 to 5 months. More extensive prostate intraepithelial neoplasia and focal microinvasion occurred at 7 to 9 months; invasive prostate carcinoma was detected in all male PSA-Cre;Pten-loxP/loxP mice at 10 to 14 months. At 15 to 16 months, a rare lymph node metastasis was found. In hyperplastic cells and in tumor cells, the expression of phospho-AKT was up-regulated. In hyperplastic and tumor cells, expression of luminal epithelial cell cytokeratins was up-regulated; tumor cells were negative for basal epithelial cell cytokeratins. Androgen receptor expression remained detectable at all stages of tumor development. The up-regulation of phospho-AKT correlated with an increased proliferation rate of the epithelial cells, but not with a reduced apoptosis. http://repub.eur.nl/res/pub/8364/ 2005-01-01T00:00:00Z The androgen receptor (AR) is essential for development of the male gender and in the growth of the majority of prostate cancers. Agonists as well as most antagonists induce translocation of the receptor to the nucleus, whereas only agonists can activate AR function. Antagonists are therefore used in the therapy of metastasized prostate cancer. To obtain insight into the mechanism by which antagonists block AR function in living cells, we studied nuclear mobility and localization of green fluorescent protein (GFP)-tagged AR in the presence of either the agonist R1881 or the antagonists bicalutamide and hydroxyflutamide. As controls we investigated a non-DNA-binding AR mutant (A573D) and two mutants (W741C and T877A) with broadened ligand specificity. We demonstrate that in the presence of R1881, AR localizes in numerous intranuclear foci and, using complementary fluorescence recovery after photobleaching (FRAP) approaches and computer modelling, that a fraction of AR ( approximately 10-15%) is transiently immobilized in a DNA-binding-dependent manner (individual ARs being immobile for approximately 45 seconds). By contrast, antagonist-bound GFP-AR showed no detectable immobile fraction and the mobility was similar to that of the R1881-liganded non-DNA-binding mutant (A573D), indicating that antagonists do not induce the relatively stable DNA-binding-dependent immobilization observed with agonist-bound AR. Moreover, in the presence of bicalutamide and hydroxyflutamide GFP-AR was homogeneously distributed in the nucleus. Binding of bicalutamide and hydroxyflutamide to GFP-AR(W741C) and GFP-AR(T877A), respectively, resulted in similar mobility and heterogeneous nuclear distribution as observed for R1881-liganded GFP-AR. The live cell studies indicate that the investigated antagonists interfere with events early in the transactivation function of the AR. http://repub.eur.nl/res/pub/13437/ 2004-10-15T00:00:00Z Phosphorylation of the human AR (androgen receptor) is directly correlated with the appearance of at least three AR isoforms on an SDS/polyacrylamide gel. However, it is still not clear to what extent phosphorylation is involved in the occurrence of isoforms, which sites are phosphorylated and what are the functions of these phosphosites. The human AR was expressed in COS-1 cells and AR phosphorylation was studied further by mutational analyses and by using reversed-phase HPLC and MS. The reversed-phase HPLC elution pattern of the three isoforms revealed that Ser-650 was phosphorylated constitutively. After de novo synthesis, only Ser-650 was phosphorylated in the smallest isoform of 110 kDa and both Ser-650 and Ser-94 were phosphorylated in the second isoform of 112 kDa. The hormone-induced 114 kDa isoform shows an overall increase in phosphorylation of all the isolated peptides. The activities of the Ser-Ala substitution mutant S650A (Ser-650-->Ala) was found to be identical with wild-type AR activation in four different cell lines and three different functional analyses, e.g. transactivation, N- and C-terminal-domain interaction and co-activation by transcriptional intermediary factor 2. This was also found for mutants S94A and S515A with respect to transactivation. However, the S515A mutation, which should eliminate phosphorylation of the potential mitogen-activated protein kinase site, Ser-515, resulted in an unphosphorylated form of the peptide containing Ser-650. This suggests that Ser-515 can modulate phosphorylation at another site. The present study shows that the AR isoform pattern from AR de novo synthesis is directly linked to differential phosphorylation of a distinct set of sites. After mutagenesis of these sites, no major change in functional activity of the AR was observed. http://repub.eur.nl/res/pub/13545/ 2004-10-01T00:00:00Z We characterized the specifically androgen-regulated gene (SARG), which is expressed in the androgen receptor (AR) and glucocorticoid receptor (GR) positive cell line lymph node carcinoma of the prostate-1F5 (LNCaP-1F5). SARG mRNA expression can be up-regulated by androgens, but not by glucocorticoids. SARG mRNA expression is high in prostate tissue. SARG is composed of four exons and spans a region of 14.5 kbp on chromosome 1q32.2. Transcripts of 5.5, 3.3 and 2.3 kb are the result of alternative polyadenylation. SARG mRNA splice variants lack exon 2 and vary in length of exon 1. The SARG protein has a length of 601 amino acids and is located in the cytoplasm. By screening the 18 kbp genomic sequence flanking the transcription start site we identified the imperfect direct repeat 5'-TGTGCTaacTGTTCT-3'in intron 1 as an active androgen response element (ARE-SARG+4.6). A 569 bp genomic DNA fragment containing this element functioned as an androgen-specific enhancer in transiently transfected LNCaP-1F5 cells. ARE-SARG+4.6 cooperated with flanking sequences for optimal activity. Inactivation of ARE-SARG+4.6 completely abolished the androgen response of the enhancer. Chromatin immunoprecipitation (ChIP) experiments showed chromatin structural changes of the enhancer in the presence of R1881. ARE-SARG+4.6 was able to bind to the androgen receptor, but not to the glucocorticoid receptor, correlating with its androgen-specific activity in transfections. http://repub.eur.nl/res/pub/13416/ 2004-09-01T00:00:00Z Among nuclear receptors, the androgen receptor (AR) is unique in that its ligand-binding domain (LBD) interacts with the FXXLF motif in the N-terminal domain, resembling coactivator LXXLL motifs. We compared AR- and estrogen receptor alpha-LBD interactions of the wild-type AR FXXLF motif and coactivator transcriptional intermediary factor 2 LXXLL motifs and variants of these motifs. Random mutagenesis revealed a key role for the F residues in FXXLF motifs in high-affinity and selective AR LBD interaction. The FXXLF motif in full-length AR and transcriptional intermediary factor 2 LXXLL motifs competed for an overlapping binding site. A computer model of the AR LBD/AR FXXLF complex showed that the bulky F residues are buried in a deep coactivator-binding groove. The corresponding groove in estrogen receptor alpha LBD is considerably shallower, explaining lack of binding of any of the FXXLF motifs tested. FXXLF and LXXLL motif interaction depended on different charged amino acid residues in the AR LBD present at opposite ends of the coactivator groove. In conclusion, our data demonstrate the importance of a deep hydrophobic groove and alternative usage of charged amino acids in specifying peptide binding to the AR LBD. http://repub.eur.nl/res/pub/13289/ 2004-05-01T00:00:00Z Antiandrogens are widely used agents in the treatment of prostate cancer, as inhibitors of AR (androgen receptor) action. Although the precise mechanism of antiandrogen action is not yet elucidated, recent studies indicate the involvement of nuclear receptor co-repressors. In the present study, the regulation of AR transcriptional activity by N-CoR (nuclear receptor co-repressor), in the presence of different ligands, has been investigated. Increasing levels of N-CoR differentially affected the transcriptional activity of AR occupied with either agonistic or antagonistic ligands. Small amounts of co-transfected N-CoR repressed CPA (cyproterone acetate)- and mifepristone (RU486)-mediated AR activity, but did not affect agonist (R1881)-induced AR activity. Larger amounts of co-transfected N-CoR repressed AR activity for all ligands, and converted the partial agonists CPA and RU486 into strong AR antagonists. In the presence of the agonist R1881, co-expression of the p160 co-activator TIF2 (transcriptional intermediary factor 2) relieved N-CoR repression up to control levels. However, in the presence of RU486 and CPA, TIF2 did not functionally compete with N-CoR, suggesting that antagonist-bound AR has a preference for N-CoR. The AR mutation T877A (Thr877-->Ala), which is frequently found in prostate cancer and affects the ligand-induced conformational change of the AR, considerably reduced the repressive action of N-CoR. The agonistic activities of CPA- and hydroxyflutamide-occupied T877A-AR were hardly affected by N-CoR, whereas TIF2 strongly enhanced their activities. These results indicate that lack of N-CoR action allows these antiandrogens to act as strong agonists on the mutant AR. http://repub.eur.nl/res/pub/10020/ 2002-01-01T00:00:00Z The N-terminal domain (NTD) and the ligand-binding domain (LBD) of the androgen receptor (AR) exhibit a ligand-dependent interaction (N/C interaction). Amino acids 3-36 in the NTD (AR3-36) play a dominant role in this interaction. Previously, it has been shown that a PhixxPhiPhi motif in AR3-36, 23FxxLF27, is essential for LBD interaction. We demonstrate in the current study that AR3-36 can be subdivided into two functionally distinct fragments: AR3-13 and AR16-36. AR3-13 does not directly interact with the AR LBD, but rather contributes to the transactivation function of the AR.NTD-AR.LBD complex. AR16-36, encompassing the 23FxxLF27 motif, is predicted to fold into a long amphipathic alpha-helix. A second PhixxPhiPhi candidate protein interaction motif within the helical structure, 30VREVI34, shows no affinity to the LBD. Within AR16-36, amino acid residues in and flanking the 23FxxLF27 motif are demonstrated to modulate N/C interaction. Substitution of Q24 and N25 by alanine residues enhances N/C interaction. Substitution of amino acids flanking the 23FxxLF27 motif by alanines are inhibitory to LBD interaction. http://repub.eur.nl/res/pub/8755/ 1998-01-01T00:00:00Z In the androgen receptor of a patient with androgen insensitivity, the alanine residue at position 564 in the first zinc cluster of the DNA-binding domain was substituted by aspartic acid. In other members of the steroid receptor family, either valine or alanine is present at the corresponding position, suggesting the importance of a neutral amino acid residue at this site. The mutant receptor was transcriptionally inactive, which corresponded to the absence of specific DNA binding in gel retardation assays, and its inactivity in a promoter interference assay. Two other receptor mutants with a mutation at this same position were created to study the role of position 564 in the human androgen receptor on DNA binding in more detail. Introduction of asparagine at position 564 resulted in transcription activation of a mouse mammary tumor virus promoter, although at a lower level compared with the wild-type receptor. Transcription activation of an (ARE)2-TATA promoter was low, and binding to different hormone response elements could not be visualized. The receptor with a leucine residue at position 564 was as active as the wild-type receptor on a mouse mammary tumor virus promoter and an (ARE)2-TATA promoter, but interacted differentially with several hormone response elements in a gel retardation assay. The results of the transcription activation and DNA binding studies could partially be predicted from three-dimensional modeling data. The phenotype of the patient was explained by the negative charge, introduced at position 564. http://repub.eur.nl/res/pub/8892/ 1998-01-01T00:00:00Z Previous studies in yeast and mammalian cells showed a functional interaction between the amino-terminal domain and the carboxy-terminal, ligand-binding domain (LBD) of the human androgen receptor (AR). In the present study, the AR subdomains involved in this in vivo interaction were determined in more detail. Cotransfection experiments in Chinese hamster ovary (CHO) cells and two-hybrid experiments in yeast revealed that two regions in the NH2-terminal domain are involved in the functional interaction with the LBD: an interacting domain at the very NH2 terminus, located between amino acid residues 3 and 36, and a second domain, essential for transactivation, located between residues 370 and 494. Substitution of glutamic acid by glutamine at position 888 (E888Q) in the AF-2 activation domain (AD) core region in the LBD, markedly decreased the interaction with the NH2-terminal domain. This mutation neither influenced hormone binding nor LBD homodimerization, suggesting a role of the AF-2 AD core region in the functional interaction between the NH2-terminal domain and the LBD. The AF-2 AD core region was also involved in the interaction with the coactivator TIF2 (transcriptional intermediary factor 2), as the E888Q mutation decreased the stimulatory effect of TIF2 on AR AF-2 activity. Cotransfection of TIF2 and the AR NH2-terminal domain expression vectors did not result in synergy between both factors in the induction of AR AF-2 activity. TIF2 highly induced AR AF-2 activity on a complex promoter [mouse mammary tumor virus (MMTV)], but it was hardly active on a minimal promoter (GRE-TATA). In contrast, the AR NH2-terminal domain induced AR AF-2 activity on both promoter constructs. These data indicate that both the AR NH2-terminal domain and the coactivator TIF2 functionally interact, either directly or indirectly, with the AF-2 AD core region in the AR-LBD, but the level of transcriptional response induced by TIF2 depends on the promoter context. http://repub.eur.nl/res/pub/8710/ 1997-01-01T00:00:00Z Prostate-specific antigen (PSA) is a kallikrein-like serine protease, which is almost exclusively synthesized in the luminal epithelial cells of the human prostate. PSA expression is androgen regulated. Previously, we characterized in vitro the proximal promoter, and a strong enhancer region, approximately 4 kb upstream of the PSA gene. Both regions are needed for high, androgen-regulated activity of the PSA promoter in LNCaP cells. The goal of the present study is the in vivo characterization of the PSA promoter. Three transgenic mouse lines carrying the Escherichia coli LacZ gene, driven by the 632-bp proximal PSA promoter, and three lines with LacZ, driven by the 6-kb PSA promoter, were generated. Expression of the LacZ reporter gene was analyzed in a large series of tissues. Transgene expression could not be demonstrated in any of the transgenic animals carrying the proximal PSA promoter. All three lines carrying the 6-kb PSA promoter showed lateral prostate-specific beta-galactosidase activity. Transgene expression was undetectable until 8 weeks after birth. Upon castration, beta-galactosidase activity rapidly declined. It could be restored by subsequent androgen administration. A search for mouse PSA-related kallikrein genes expressed in the prostate led to the identification of mGK22, which was previously demonstrated to be expressed in the submandibular salivary gland. Therefore, the 6-kb PSA-LacZ transgene followed the expression pattern of the PSA gene in humans, which is almost completely prostate-specific, rather than that of mGK22 in mice. In conclusion, the 6-kb promoter fragment appears to contain most, if not all, information for androgen regulation and prostate specificity of the PSA gene. http://repub.eur.nl/res/pub/8726/ 1997-01-01T00:00:00Z In the coding part and the intron-exon boundaries of the androgen-receptor gene of a patient with partial androgen insensitivity, no mutation was found. The androgen receptor of this patient displayed normal ligand-binding parameters and migrated as a 110-112-kD doublet on SDS-PAGE in the absence of hormone. However, after culturing of the patient's genital skin fibroblasts in the presence of hormone, the slower-migrating 114-kD protein, which reflects hormone-dependent phosphorylation, was hardly detectable. Furthermore, receptor protein was undetectable in the nuclear fraction of the fibroblasts, after treatment with hormone, which is indicative of defective DNA binding. By sequencing part of intron 2, a T-->A mutation was found 11 bp upstream of exon 3. In our screening of 102 chromosomes from unrelated individuals, this base-pair substitution was not found, indicating that it was not a polymorphism. mRNA analysis revealed that splicing involved a cryptic splice site, located 71/70 bp upstream of exon 3, resulting in generation of mRNA with an insert of 69 nucleotides. In addition, a small amount of a transcript with a deleted exon 3 and a very low level of wild-type transcript were detected. Translation of the extended transcript resulted in an androgen-receptor protein with 23 amino acid residues inserted between the two zinc clusters, displaying defective DNA binding and defective transcription activation. http://repub.eur.nl/res/pub/8735/ 1997-01-01T00:00:00Z Androgen receptor-positive LNCaP cells were stably transfected with a rat glucocorticoid receptor (GR) expression plasmid. Ligand-binding studies in the generated cell lines revealed high-affinity binding of the cognate ligands to their receptors. Transfection experiments with the newly derived cell lines showed that, like androgen receptor, GR can induce activity of a prostate-specific antigen promoter fragment linked to the luciferase gene. Similarly, dexamethasone can stimulate expression of endogenous prostate-specific antigen messenger RNA. Cell proliferation could be induced by R1881. In contrast, dexamethasone treatment of the GR-positive sublines had no stimulatory effect on cell growth. Using the differential display technique, a so far unknown complementary DNA fragment, designated 21.1, specifically induced by androgens and not by glucocorticoids, has been identified. In conclusion, the newly generated cell lines, together with the parental LNCaP cell line, form an attractive system with which to study the mechanism of specificity of steroid hormone regulation of gene expression. http://repub.eur.nl/res/pub/8609/ 1996-01-01T00:00:00Z Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity. http://repub.eur.nl/res/pub/8612/ 1996-01-01T00:00:00Z Transglutaminases (TGases) are calcium-dependent enzymes catalysing the post-translational cross-linking of proteins. In the prostate at least two TGases are present, the ubiquitously expressed tissue-type TGase (TGC), and a prostate-restricted TGase (TGP). This paper deals with the molecular cloning and characterization of the cDNA encoding the human prostate TGase (hTGP). For this purpose we have screened a human prostate cDNA library with a probe from the active-site region of TGC. The largest isolated cDNA contained an open reading frame encoding a protein of 684 amino acids with a predicted molecular mass of 77 kDa as confirmed by in vitro transcription-translation and subsequent SDS/PAGE. The hTGP gene was tissue-specifically expressed in the prostate, yielding an mRNA of approx. 3.5 kb. Furthermore, a 3-fold androgen-induced upregulation of hTGP mRNA expression has been demonstrated in the recently developed human prostate cancer cell line, PC346C. Other well established human prostate cancer cell lines, LNCaP and PC-3, showed no detectable hTGP mRNA expression on a Northern bolt. The gene coding for prostate TGase was assigned to chromosome 3. http://repub.eur.nl/res/pub/8551/ 1995-01-01T00:00:00Z To locate in detail the regions in the human androgen receptor (AR) involved in transcription activation, a series of N-terminal deletions was introduced in the wild type AR and in a constitutively active AR. The different constructs were tested for their capacity to activate transcription. Almost the entire N-terminal domain (residues 1-485) was necessary for full wild type AR activity when cotransfected with the (GRE)2tkCAT reporter in HeLa cells. In contrast, a smaller part of the N-terminal domain (amino acids 360-528) was sufficient for the constitutively active AR to induce transcription of the same (GRE)2tkCAT reporter in HeLa cells. This demonstrates the capacity of the AR to use different regions in the N-terminal domain as transcription activation units (TAUs). To obtain additional information of AR N-terminal TAUs, the GAL4 DNA binding domain was linked to either the entire or parts of the AR N-terminal domain and cotransfected with the (UAS)2tkCAT reporter in HeLa cells. The results confirmed that the first 485 amino acid residues accommodate a transcription activation function. When the chimeric AR-GAL4 constructs were tested on a different reporter ((UAS)5E1bCAT), a small shift in position of the TAU, responsible for full transcription activation, was observed. The data presented show that the size and location of the active TAU in the human AR is variable, being dependent on the promoter context and the presence or absence of the ligand binding domain. http://repub.eur.nl/res/pub/8595/ 1993-01-01T00:00:00Z Translation of androgen receptor (AR) cRNA in a reticulocyte lysate and subsequent analysis of the translation products by SDS/PAGE showed a protein with an apparent molecular mass of 108 kDa. Scatchard-plot analysis revealed a single binding component with high affinity for R1881 (Kd = 0.3 nM). All AR molecules synthesized specifically bound steroid. No evidence for AR phosphorylation during in vitro synthesis was found. When AR was labelled with [3H]R1881 and analysed on sucrose-density gradients, a complex of approx. 6 S was observed. The complex was shifted to a higher sedimentation coefficient after incubation with a monoclonal AR antibody directed against an epitope in the DNA-binding domain. In the presence as well as the absence of hormone, AR molecules were able to bind to DNA-cellulose without an activation step. Gel retardation assays revealed that the AR forms complexes with a DNA element containing glucocorticoid-responsive element/androgen-responsive element sequences. Receptor-DNA interactions were stabilized by different polyclonal antibodies directed against either the N- or C-terminal part of the AR and were abolished by an antibody directed against the DNA-binding domain of the receptor. In conclusion, translation of AR cRNA in vitro yields an activated AR protein which binds steroid with high affinity. It is proposed that AR antibodies enhance AR-DNA binding by stabilizing AR dimers when bound to DNA. http://repub.eur.nl/res/pub/8883/ 1992-01-01T00:00:00Z Cooperative actions of FSH and androgens on initiation, maintenance, and restoration of spermatogenesis have been described. In the present experiments the regulatory effects of FSH on androgen receptor (AR) gene expression in Sertoli cells were studied. In immature rats injection of FSH (1 microgram/g BW, ip) resulted in a rapid down-regulation of testicular AR mRNA expression (4 h), followed by recovery to the control level (10 h). Using cultured immature Sertoli cells, a similar transient effect on AR mRNA expression was observed after the addition of FSH (500 ng/ml) or (Bu)2cAMP (0.5 mM). Cycloheximide treatment of the cells did not prevent the rapid FSH-induced down-regulation of AR mRNA expression, indicating that de novo protein synthesis is not required for this effect. Furthermore, using a transcriptional run-on assay, no marked decrease in the rate of AR gene transcription was found upon treatment of the cultured Sertoli cells with FSH for 2 or 4 h. This demonstrates that the short term effect of FSH or AR mRNA expression reflects a change in mRNA stability. The AR protein level was not markedly affected by the transient decrease in AR mRNA expression. When immature Sertoli cells were incubated with FSH for longer time periods (24-72 h), both AR mRNA and protein expression were increased. In Sertoli cells isolated from 15-day-old rats, this increase was higher (mRNA, 2- to 3-fold; protein, 2-fold) than in Sertoli cells isolated from 25-day-old animals. The results indicate that FSH plays a complex role in the regulation of AR expression in immature rat Sertoli cells http://repub.eur.nl/res/pub/8890/ 1990-01-01T00:00:00Z The androgen receptor (AR) is activated upon binding of testosterone or dihydrotestosterone and exerts regulatory effects on gene expression in androgen target cells. To study transcriptional regulation of the rat AR gene itself, the 5' genomic region of this gene was cloned from a genomic library and the promoter was identified. S1-nuclease protection analysis showed two major transcription start sites, located between 1010 and 1023 bp upstream from the translation initiation codon. The area surrounding these start sites was cloned in both orientations in a CAT reporter plasmid. Upon transfection of the constructs into COS cells, part of the promoter stimulated transcription in an orientation-independent manner, but the full promoter showed a higher and unidirectional activity. In the promoter/reporter gene constructs, transcription initiated from the same positions as in the native gene. Sequence analysis showed that the promoter of the rat AR gene lacks typical TATA and CCAAT box elements, but one SP1 site is located at about 60 bp upstream from the major start site of transcription. Other possible promoter elements are TGTYCT sequences at positions -174 to -179, -434 to -439., -466 to -471, and -500 to -505, resembling half-sites of the glucocorticoid-responsive element (GRE). Furthermore, a homopurine stretch containing a total of 8 GGGGA elements and similar to sequences that are present in several other GC-rich promoters, is located between -89 and -146 bp upstream from the major start site of transcription