Brinkmann, A.O.

Functional analysis of novel androgen receptor mutations in a unique cohort of Indonesian patients with a disorder of sex development (Article)

2009-12-01T00:00:00Z

Mutations in the androgen receptor (AR) gene, rendering the AR protein partially or completely inactive, cause androgen insensitivity syndrome, which is a form of a 46,XY disorder of sex development (DSD). We present 3 novel AR variants found in a cohort of Indonesian DSD patients: p.I603N, p.P671S, and p.Q738R. The aim of this study was to determine the possible pathogenic nature of these newly found unclassified variants. To investigate the effect of these variants on AR function, we studied their impact on transcription activation, AR ligand-binding domain interaction with an FxxLF motif containing peptide, AR subcellular localization, and AR nuclear dynamics and DNA-binding. AR-I603N had completely lost its transcriptional activity due to disturbed DNA-binding capacity and did not show the 114-kDa hyperphosphorylated AR protein band normally detectable after hormone binding. The patient with AR-I603N displays a partial androgen insensitivity syndrome phenotype, which is explained by somatic mosaicism. A strongly reduced transcriptional activity was observed for AR-Q738R, together with diminished interaction with an FxxLF motif containing peptide. AR-P671S also showed reduced transactivation ability, but no change in DNA- or FxxLF-binding capacity and interferes with transcriptional activity for as yet unclear reasons.

DNA dependent recruitment of DDX17 and other interacting proteins by the human androgen receptor (Article)

2009-02-01T00:00:00Z

An oligonucleotide-based assay (OBA) was used to identify novel co-factors that can be recruited by the deoxyribonucleic acid (DNA)-bound androgen receptor (AR). Nuclear extracts obtained from LNCaP cells, after incubation with R1881, were incubated with biotinylated oligonucleotides bound to streptavidin coated beads. The oligonucleotides contain 3 copies in tandem of the androgen responsive element ARE1 from the prostate specific antigen (PSA) gene promoter. As control incubation, a scrambled version of the tandem ARE1 was used. Immunoblots of the eluents revealed that the AR was bound to the ARE1 oligonucleotide and to a much lesser extent to the scrambled oligonucleotide. Proteins eluted from the oligonucleotides, were separated on a 5-15% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gradient gel, followed by identification using mass spectrometry. Identified proteins were scored for having one or more of the following known properties: nuclear localization, involved in transcription regulation, involvement in steroid hormone receptor (SHR) function, or specifical involvement in AR function. A total number of 85 nuclear proteins were found in two separate OBAs. Based on peptide counting, we found enrichment of 7 proteins eluted from the ARE1 oligonucleotide, compared to the scrambled oligonucleotide. Taken together with the obtained scores, these proteins are considered putative AR co-factors. One of these proteins, DDX17, is known to be a co-factor for estrogen receptor α (ERα), but has never been associated with AR function. The results indicate that the ARE oligonucleotide-based assay may allow enrichment of new candidate DNA-bound AR interacting proteins. Crown Copyright

Prediction of Progression of Non-Muscle-Invasive Bladder Cancer by WHO 1973 and 2004 Grading and by FGFR3 Mutation Status: A Prospective Study (Article)

2008-10-01T00:00:00Z

Objectives: The clinical management of non-muscle-invasive urothelial cell carcinoma of the bladder (UCC) is challenging, as it has a marked tendency to recur and to progress. Aim of this study was to investigate the prognostic value of the WHO 1973 and 2004 grading systems and biomarkers FGFR3, CK20 and Ki-67. Methods: In a prospective study, tumours from 221 patients were studied for the expression of CK20 and Ki-67 by immunohistochemistry, and FGFR3 status by SNaPshot mutation detection. Staging and grading were performed according to the WHO classification systems of 1973 and 2004. Results: : Median follow-up was 35 mo. Recurrence occurred in 72 of 221 patients. None of the parameters was able to predict disease recurrence. CK20, Ki-67, FGFR3 mutation, molecular grade using FGFR3 mutation analysis and Ki-67, and histological grading and staging were significantly associated with disease progression in stage. In multivariable analyses, WHO 1973 and 2004 grading systems remained statistically significant and independent predictors of progression, with p = 0.005 for WHO 1973 and p = 0.004 for 2004. FGFR3 status was able to discriminate progressors from nonprogressors in a subset of patients with high-grade UCC (p = 0.009). Conclusions: This is the first prospective study comparing the WHO 1973 and 2004 grading systems. We show that both grading systems contribute valuable independent information. Therefore, it should be considered whether a better grading system could be developed that incorporates essential elements from both. The combination of WHO 2004 grading with FGFR3 status allows a better risk stratification for patients with high-grade non-muscle-invasive UCC.

A novel mutation F826L in the human androgen receptor in partial androgen insensitivity syndrome; increased NH2-/COOH-terminal domain interaction and TIF2 co-activation (Article)

2008-09-24T00:00:00Z

A novel mutation F826L located within the ligand binding domain (LBD) of the human androgen receptor (AR) was investigated. This mutation was found in a boy with severe penoscrotal hypospadias (classified as 46,XY DSD). The AR mutant F826L appeared to be indistinguishable from the wild-type AR, with respect to ligand binding affinity, transcriptional activation of MMTV-luciferase and ARE2-TATA-luciferase reporter genes, protein level in genital skin fibroblasts (GSFs), and sub-cellular distribution in transfected cells. However, an at least two-fold higher NH2-/COOH-terminal domain interaction was found in luciferase and GST pull-down assays. A two-fold increase was also observed for TIF2 (transcription intermediary factor 2) co-activation of the AR F826L COOH-terminal domain. This increase could not be explained by a higher stability of the mutant protein, which was within wild-type range. Repression of transactivation by the nuclear receptor co-repressor (N-CoR) was not affected by the AR F826L mutation. The observed properties of AR F826L would be in agreement with an increased activity rather than with a partial defective AR transcriptional activation. It is concluded that the penoscrotal hypospadias in the present case is caused by an as yet unknown mechanism, which still may involve the mutant AR.

Detailed functional studies on androgen receptor mild mutations demonstrate their association with male infertility (Article)

2008-04-01T00:00:00Z

Context: Mutations in the androgen receptor (AR) gene can cause the androgen insensitivity syndrome (AIS). For complete and severe partial AIS, well-characterized in vitro functional assays can be used for genotype-phenotype correlation; however, for mild forms of AIS, as associated with male infertility, experimental evidence is scarce or lacking. In particular, optimal in vitro functional tests informative about the genotype-phenotype relation have not been described. Objective: The objective of this study was to investigate the association among genotype and phenotype for AR mutations found in infertile males by conventional functional assays and additional in-depth studies performed with several gene reporters. Design: To this aim, we selected four AR missense mutations associated with isolated male infertility (L547F and two novel mutations A474V and S650G) or partial AIS (Y571H). After introduction of the specific mutations in AR expression plasmid, we performed classical in vitro studies (Western immunoblotting, electrophoretic mobility shift assay, hormone-response curves) and transactivation assays with different reporter constructs (MMTV, Sc-ARU-TK, TAT-GRE- 2X, Slp-ARU-TK and PEM). Results and conclusions: Our results showed that standard functional tests provide sufficient information only for severe AR mutations, whereas for AR mutations found in mild AIS patients with male infertility, only an extensive analysis with different in vitro systems, and in particular with PEM promoter, can give information on the functionality of the AR and therefore on the pathogenicity of the mutations and on genotype-phenotype correlation.

Proteomic analysis of proteins regulated by TRPS1 transcription factor in DU145 prostate cancer cells (Article)

2007-05-01T00:00:00Z

The aim of the present study was to identify proteins differentially regulated by TRPS1 in human prostate cancer cells in order to better understand the role of TRPS1 in prostate cancer development. The proteomes of androgen-independent DU145 prostate cancer cells, that do not express TRPS1 and of genetically engineered DU145 cells that stable and inducible express recombinant TRPS1 protein, were compared. Using two-dimensional electrophoresis followed by mass spectrometric analysis, 13 proteins that were differentially expressed between these two cell lines were identified. These proteins represent a dominant reduction of expression of antioxidant proteins, including superoxide dismutase, protein disulfide isomerase A3 precursor, endoplasmin precursor and annexin A2. Furthermore, regulation was observed for mitochondrion-associated proteins, glycolytic enzymes, a cytoskeleton-associated protein, a nuclear protein and proteins involved in apoptosis. Our data indicate that overexpression of TRPS1 protein is correlated with reduced protein expression of certain antioxidants. This suggests a possible involvement of TRPS1 in oxidative stress, and possibly in apoptosis in androgen-independent DU145 prostate cancer cells.

Associations between promoter usage and alternative splicing of the glucocorticoid receptor gene (Article)

2007-02-01T00:00:00Z

The glucocorticoid receptor (GR) is widely expressed in various tissues throughout the human body. At least three different 3′-splice variants of the GR have been reported: GR-α, which is functionally active; GR-β, which is a dominant negative inhibitor of GR-α function; and GR-P, which is thought to activate the function of GR-α. At least seven different variants for exon 1 exist, 1A-1F and 1H, each with its own promoter. In this study, we explored if tissue-specific splicing of the 3′-end variants of the GR is influenced by alternative promoter usage. cDNAs of different tissues and cell lines were used to investigate which part of transcripts carrying each of the three major variants for exons 1, 1A, 1B, or 1C, encodes for the splice variants GR-α, GR-β, and GR-P. Our data demonstrate that the expression of GR-α is preferentially regulated by promoter 1C and that for the expression of GR-P promoter 1B is predominantly used. This indicates that regulation of GR splice variants could partly occur through selective use of the multiple promoters, and that this is another way to sensitize cells and tissues to the different activities of the GR isoforms.

Lack of Association of the 11beta-hydroxysteroid dehydrogenase type 1 gene 83,557insA and hexose-6-phosphate dehydrogenase gene R453Q polymorphisms with body composition, adrenal androgen production, blood pressure, glucose metabolism, and dementia. (Article)

2007-01-01T00:00:00Z

CONTEXT: Recently, it was proposed that a combination of the 83,557insA polymorphism in the 11beta-hydroxysteroid dehydrogenase type 1 (HSD11B1) gene and the R453Q polymorphism in the hexose-6-phosphate dehydrogenase (H6PD) gene interacts to cause cortisone reductase deficiency (CRD) when at least three alleles are affected. OBJECTIVE: The aim was to study the separate and combined effects of these polymorphisms on body composition, adrenal androgen production, blood pressure, glucose metabolism, and the incidence of dementia in the healthy elderly population. DESIGN/SETTING/PARTICIPANTS: The Rotterdam study (n = 6105) and the Frail Old Men study (n = 347) are population-based cohort studies in the elderly. MAIN OUTCOME MEASURES: Genotype distributions and influences of (combined) genotypes on body mass index, adrenal androgen production, waist to hip ratio, systolic and diastolic blood pressure, fasting glucose levels, glucose tolerance test, and incidence of dementia were measured. RESULTS: No influence of the HSD11B1 83,557insA (allele frequencies 22.0 and 21.5%) and H6PD R453Q (allele frequencies 22.9 and 20.2%) variants was found for the different outcome measures that were investigated, either separately or when at least three alleles were affected. CONCLUSIONS: Two population-based studies among Caucasian elderly showed no evidence for (combined) effects of two polymorphisms in the HSD11B1 and H6PD genes on body composition, adrenal androgen production, blood pressure, glucose metabolism, and incidence of dementia. Moreover, the high frequencies observed for these two polymorphisms do not correspond to the low incidence of CRD observed in the general population. Altogether, it is unlikely that these polymorphisms cause CRD.

Two polymorphisms in the glucocorticoid receptor gene directly affect glucocorticoid-regulated gene expression. (Article)

2005-10-01T00:00:00Z

CONTEXT: Interindividual variation in glucocorticoid (GC)-sensitivity can be partly explained by polymorphisms in the GC receptor (GR) gene. The ER22/23EK and N363S polymorphisms have been described to be associated with lower and higher GC sensitivity, respectively. OBJECTIVE AND DESIGN: We examined the basis of this altered GC sensitivity by expressing GR(N363S) and GR(ER22/23EK) in COS-1 cells and investigating their transactivating and transrepressing capacities using a GC response element-luciferase reporter and a p65-activated nuclear factor kappaB-luciferase reporter, respectively. Furthermore, we evaluated the transactivating and transrepressing capacities of the GR in peripheral blood mononuclear lymphocytes of homozygous and heterozygous carriers of these polymorphisms by determining the maximum effect of dexamethasone on transactivation of the GC-induced leucine-zipper and transinhibition of the IL-2 gene by means of real-time RT-PCR. RESULTS: The effects of the polymorphisms in the GR gene previously observed in population studies were also detected at the level of gene expression. The ER22/23EK polymorphism resulted in a significant reduction of transactivating capacity, in both transfection experiments (-14 +/- 5%, P < 0.05) and peripheral blood mononuclear lymphocytes of carriers of this polymorphism (homozygous: -48 +/- 6%, P < 0.01, n = 1; heterozygous: -21 +/- 4%, P = 0.08, n = 3). The N363S polymorphism, associated with increased GC sensitivity, resulted in a significantly increased transactivating capacity, both in vitro (8 +/- 3%; P < 0.02) and ex vivo (homozygous: 204 +/- 19%, P < 0.0001, n = 1; heterozygous: 124 +/- 8%, P = 0.05, n = 3). Neither the ER22/23EK nor the N363S polymorphism seemed to influence the transrepressing capacity of the GR. CONCLUSION: The presence of these and other GC sensitivity-modulating polymorphisms may have consequences for the use of GCs in a clinical setting.

A common polymorphism in the CYP3A7 gene is associated with a nearly 50% reduction in serum dehydroepiandrosterone sulfate levels. (Article)

2005-09-01T00:00:00Z

CONTEXT: CYP3A7, expressed in the human fetal liver and normally silenced after birth, plays a major role in the 16alpha-hydroxylation of dehydroepiandrosterone (DHEA), DHEA sulfate (DHEAS), and estrone. Due to a replacement of part of the CYP3A7 promoter with a sequence identical with the same region in the CYP3A4 promoter (referred to as CYP3A7*1C), some individuals still express a variant of the CYP3A7 gene later in life. OBJECTIVE: The objective of this study was to examine the effect of the CYP3A7*1C polymorphism on serum steroid hormone levels. DESIGN, SETTING, PARTICIPANTS: Two population-based cohort studies were performed. Study group 1 consisted of 208 subjects randomly selected from the Rotterdam Study, and study group 2 consisted of 345 elderly independently living men. MAIN OUTCOME MEASURES: Serum DHEA(S), androstenedione, estradiol, estrone, and testosterone levels were the main outcome measures. RESULTS: In study groups 1 and 2, heterozygous CYP3A7*1C carriers had almost 50% lower DHEAS levels compared with homozygous carriers of the reference allele [study group 1, 1.74 +/- 0.25 vs. 3.33 +/- 0.15 micromol/liter (P = 0.02); study group 2, 2.09 +/- 0.08 vs. 1.08 +/- 0.12 micromol/liter (P < 0.001)]. No differences in circulating DHEA, androstenedione, estradiol, or testosterone levels were found. However, in study group 2, serum estrone levels were lower in heterozygous CYP3A7*1C carriers compared with homozygous carriers of the reference allele (0.11 +/- 0.002 vs. 0.08 +/- 0.006 nmol/liter; P < 0.001). CONCLUSION: The CYP3A7*1C polymorphism causes the persistence of enzymatic activity of CYP3A7 during adult life, resulting in lower circulating DHEAS and estrone levels.

Increased expression of the glucocorticoid receptor-A translational isoform as a result of the ER22/23EK polymorphism. (Article)

2005-07-01T00:00:00Z

One of the most intriguing polymorphisms in the GR [glucocorticoid (GC) receptor] gene is in codons 22 and 23 [GAGAGG(GluArg) --> GAAAAG (GluLys)]. This polymorphism is associated with a reduced GC sensitivity, a better metabolic and cardiovascular health profile, and an increased survival rate. Recently, Yudt and Cidlowski reported that two different methionine codons in the GR mRNA may be used as initiation codon: AUG-1 and AUG-27, resulting in two isoforms, the GR-A and the GR-B proteins, respectively. They also showed that the GR-B protein had a stronger transactivating effect in transient transfection experiments. In this study, we elucidated the molecular basis for the reduced GC sensitivity by investigating the influence of the ER22/23EK polymorphism on synthesis of GR-A and GR-B by expressing them independently from constructs with and without the polymorphic site. Binding studies with [(3)H]-dexamethasone and transactivation studies showed that, when the ER22/23EK polymorphism is present, approximately 15% more GR-A protein was expressed, whereas total GR levels (GR-A + GR-B) were not affected. These results show that the transcriptional activity in GR(ER22/23EK) carriers is decreased because more of the less transcriptionally active GR-A isoform is formed. This is probably caused by altered secondary mRNA structure.

Differential regulation of synthetic glucocorticoids on gene expression levels of glucocorticoid-induced leucine zipper and interleukin-2. (Article)

2005-05-01T00:00:00Z

Individual glucocorticoid (GC) sensitivity was determined by measuring the effects of several clinically used GCs on transactivation of the GC-induced leucine zipper (GILZ) gene and on transrepression of the IL-2 gene using quantitative real-time PCR. A clear difference in relative potencies for transactivation and transrepression of the various GCs was observed, suggesting differential effects. To determine whether the in vitro outcomes could predict in vivo effects of GCs, 15 individuals underwent a 0.25-mg dexamethasone (DEX) suppression test (DST) while determining GILZ and IL-2 mRNA levels in their peripheral blood mononuclear cells incubated with hydrocortisone, DEX, budesonide, and prednisolone. No correlations were found between the DST and the two expression assays. However, significant correlations existed between hydrocortisone and DEX (r = 0.52; P = 0.046), hydrocortisone and budesonide (r = 0.48; P = 0.069), and hydrocortisone and prednisolone (r = 0.86; P = 0.007) regarding GILZ mRNA levels, and between hydrocortisone and DEX (r = 0.62; P = 0.014), hydrocortisone and budesonide (r = 0.71; P = 0.003), and hydrocortisone and prednisolone (r = 0.71; P = 0.047) regarding IL-2 mRNA levels. In conclusion, intra- and inter-individual variations in GC sensitivity were observed using two expression assays representing GC-mediated transactivation and transrepression. The two expression assays did not correlate with each other or with the results of the DST. This suggests that regulation of the hypothalamic-pituitary-adrenal axis is more complex. However, within an individual person, these two tests combined might predict what type and dosage of GC will be preferable in individual patients for its inhibitory clinical effects, together with relatively fewer transactivating effects related to adverse effects.

Functional analysis of a novel androgen receptor mutation, Q902K, in an individual with partial androgen insensitivity. (Article)

2005-01-01T00:00:00Z

Androgen insensitivity syndrome (AIS) is caused by defects in the androgen receptor (AR) that render the AR partially or completely inactive. As a result, embryonic sex differentiation is impaired. Here, we describe a novel mutation in the AR found in a patient with partial AIS. The mutation results in a substitution of a glutamine (Q) by a lysine (K) residue at position 902, Q902K. The AR Q902K mutation was investigated in vitro with respect to its functional properties. The equilibrium dissociation constants (K(d)s) of AR Q902K in the presence of either the synthetic androgen R1881 or the natural ligand DHT were slightly elevated. The R1881 dissociation rate (t(1/2)) was increased 3-fold for AR Q902K compared with wild type. Transcriptional activity was decreased to 85% of wild type, and the dose-response curve revealed that the sensitivity to hormone was decreased due to the mutation. Furthermore, the 114-kDa androgen-induced phosphorylated AR protein band was not detectable in genital skin fibroblasts. However, it could be detected in transfected CHO cells expressing the mutant receptor in the presence of 10 and 100 nm R1881. Functional interaction assays and a GST pull-down assay showed that the interaction between the NH2 and COOH terminus of AR Q902K was reduced to 50% of wild type. Furthermore, the transactivation by the coactivator TIF2 (transcriptional intermediary factor 2) was decreased 2- to 3-fold. The half-maximal response in both assays was shifted to a higher hormone concentration compared with wild type. These results indicate that residue Q902 is involved in TIF2 and NH2/COOH interaction and that the Q to K mutation results in a mild impairment of AR function, which can explain the partial AIS phenotype of the patient.

Phosphorylation of androgen receptor isoforms (Article)

2004-10-15T00:00:00Z

Phosphorylation of the human AR (androgen receptor) is directly correlated with the appearance of at least three AR isoforms on an SDS/polyacrylamide gel. However, it is still not clear to what extent phosphorylation is involved in the occurrence of isoforms, which sites are phosphorylated and what are the functions of these phosphosites. The human AR was expressed in COS-1 cells and AR phosphorylation was studied further by mutational analyses and by using reversed-phase HPLC and MS. The reversed-phase HPLC elution pattern of the three isoforms revealed that Ser-650 was phosphorylated constitutively. After de novo synthesis, only Ser-650 was phosphorylated in the smallest isoform of 110 kDa and both Ser-650 and Ser-94 were phosphorylated in the second isoform of 112 kDa. The hormone-induced 114 kDa isoform shows an overall increase in phosphorylation of all the isolated peptides. The activities of the Ser-Ala substitution mutant S650A (Ser-650-->Ala) was found to be identical with wild-type AR activation in four different cell lines and three different functional analyses, e.g. transactivation, N- and C-terminal-domain interaction and co-activation by transcriptional intermediary factor 2. This was also found for mutants S94A and S515A with respect to transactivation. However, the S515A mutation, which should eliminate phosphorylation of the potential mitogen-activated protein kinase site, Ser-515, resulted in an unphosphorylated form of the peptide containing Ser-650. This suggests that Ser-515 can modulate phosphorylation at another site. The present study shows that the AR isoform pattern from AR de novo synthesis is directly linked to differential phosphorylation of a distinct set of sites. After mutagenesis of these sites, no major change in functional activity of the AR was observed.

Distinct recognition modes of FXXLF and LXXLL motifs by the androgen receptor. (Article)

2004-09-01T00:00:00Z

Among nuclear receptors, the androgen receptor (AR) is unique in that its ligand-binding domain (LBD) interacts with the FXXLF motif in the N-terminal domain, resembling coactivator LXXLL motifs. We compared AR- and estrogen receptor alpha-LBD interactions of the wild-type AR FXXLF motif and coactivator transcriptional intermediary factor 2 LXXLL motifs and variants of these motifs. Random mutagenesis revealed a key role for the F residues in FXXLF motifs in high-affinity and selective AR LBD interaction. The FXXLF motif in full-length AR and transcriptional intermediary factor 2 LXXLL motifs competed for an overlapping binding site. A computer model of the AR LBD/AR FXXLF complex showed that the bulky F residues are buried in a deep coactivator-binding groove. The corresponding groove in estrogen receptor alpha LBD is considerably shallower, explaining lack of binding of any of the FXXLF motifs tested. FXXLF and LXXLL motif interaction depended on different charged amino acid residues in the AR LBD present at opposite ends of the coactivator groove. In conclusion, our data demonstrate the importance of a deep hydrophobic groove and alternative usage of charged amino acids in specifying peptide binding to the AR LBD.

Differential modulation of androgen receptor transcriptional activity by the nuclear receptor co-repressor (N-CoR). (Article)

2004-05-01T00:00:00Z

Antiandrogens are widely used agents in the treatment of prostate cancer, as inhibitors of AR (androgen receptor) action. Although the precise mechanism of antiandrogen action is not yet elucidated, recent studies indicate the involvement of nuclear receptor co-repressors. In the present study, the regulation of AR transcriptional activity by N-CoR (nuclear receptor co-repressor), in the presence of different ligands, has been investigated. Increasing levels of N-CoR differentially affected the transcriptional activity of AR occupied with either agonistic or antagonistic ligands. Small amounts of co-transfected N-CoR repressed CPA (cyproterone acetate)- and mifepristone (RU486)-mediated AR activity, but did not affect agonist (R1881)-induced AR activity. Larger amounts of co-transfected N-CoR repressed AR activity for all ligands, and converted the partial agonists CPA and RU486 into strong AR antagonists. In the presence of the agonist R1881, co-expression of the p160 co-activator TIF2 (transcriptional intermediary factor 2) relieved N-CoR repression up to control levels. However, in the presence of RU486 and CPA, TIF2 did not functionally compete with N-CoR, suggesting that antagonist-bound AR has a preference for N-CoR. The AR mutation T877A (Thr877-->Ala), which is frequently found in prostate cancer and affects the ligand-induced conformational change of the AR, considerably reduced the repressive action of N-CoR. The agonistic activities of CPA- and hydroxyflutamide-occupied T877A-AR were hardly affected by N-CoR, whereas TIF2 strongly enhanced their activities. These results indicate that lack of N-CoR action allows these antiandrogens to act as strong agonists on the mutant AR.

Proteomic profiling of epididymis and vas deferens: identification of proteins regulated during rat genital tract development. (Article)

2003-10-01T00:00:00Z

Epididymis and vas deferens form part of the male internal genital tract and are dependent on androgens for their growth and development. To better understand the molecular action of androgens during male genital tract development, protein expression profiles were generated using two-dimensional gels, for rat epididymides and vasa deferentia isolated on embryonic days (E) 17-21. Proteins that were differentially expressed between E17 and E21 were cut from the gels, digested into tryptic peptides and analyzed on a matrix-assisted laser desorption/ionization time-of-flight mass spectrometer. Using this approach, 20 proteins could be identified that were regulated in time and were categorized into cytoskeletal proteins, nuclear proteins, transport proteins, chaperones, and enzymes (mainly glycolytic). Furthermore, epididymides and vasa deferentia isolated on E19 were cultured in vitro in the absence or presence of 10 nm of the synthetic androgen R1881, for 9, 24, and 48 h. Under these conditions, regulation and posttranslational modification were observed for glyceraldehyde 3-phosphate dehydrogenase, triosephosphate isomerase, heterogeneous nuclear ribonucleoprotein A2/B1 and heterogeneous nuclear ribonucleoprotein A3, similar to the observed changes in vivo. In addition, posttranslational modification of RhoGDI1 (also named RhoGDIalpha) was found in response to androgen. Androgen-induced posttranslational modification of RhoGDI1 and glycolytic enzymes may be an important functional link between signaling pathways and cytoskeletal rearrangements in control of growth and development of the male internal genital tract.

Proteomic analysis of androgen-regulated protein expression in a mouse fetal vas deferens cell line (Article)

2003-04-01T00:00:00Z

During sex differentiation, androgens are essential for development of the male genital tract. The Wolffian duct is an androgen-sensitive target tissue that develops into the epididymis, vas deferens, and seminal vesicle. The present study aimed to identify androgen-regulated proteins that are involved in development of Wolffian duct-derived structures. We have used male mouse embryos transgenic for temperature-sensitive simian virus 40 large tumor antigen at 18 d of gestation, to generate immortalized mouse fetal vas deferens (MFVD) parental and clonal cell lines. The MFVD parental and clonal cell lines express androgen receptor protein and show features of Wolffian duct mesenchymal cells. Clonal cell line MFVD A6 was selected for proteomic analysis and cultured in the absence or presence of androgens. Subsequently, two-dimensional gel electrophoresis was performed on total cell lysates. Differentially expressed proteins were analyzed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and two androgen-regulated proteins were identified as mElfin and CArG-binding factor-A (CBF-A). CBF-A and mElfin are known to bind to cytoskeletal F-actin. Both proteins appeared to be regulated by androgens at the posttranslational level, possibly involving phosphorylation. Posttranslational modification of mElfin and CBF-A by androgens may be associated with a cytoskeletal change that is involved in androgen-regulated gene expression.

Proteomic analysis of androgen-regulated protein expression in a mouse fetal vas deferens cell line (Article)

2003-01-01T00:00:00Z

Consequences of loss of progesterone receptor expression in development of invasive endometrial cancer (Article)

2003-01-01T00:00:00Z

PURPOSE: In endometrial cancer, loss of progesterone receptors (PR) is associated with more advanced disease. This study aimed to investigate the mechanism of action of progesterone and the loss of its receptors (PRA and PRB) in development of endometrial cancer. EXPERIMENTAL DESIGN: A 9600-cDNA microarray analysis was performed to study regulation of gene expression in the human endometrial cancer subcell line Ishikawa PRAB-36 by the progestagen medroxy progesterone acetate (MPA). Five MPA-regulated genes were selected for additional investigation. Expression of these genes was studied by Northern blot and by immunohistochemistry in Ishikawa subcell lines expressing different PR isoforms. Additionally, endometrial cancer tissue samples were immunohistochemically stained to study the in vivo protein expression of the selected genes. RESULTS: In the PRAB-36 cell line, MPA was found to regulate the expression of a number of invasion- and metastasis-related genes. On additional investigation of five of these genes (CD44, CSPG/Versican, Tenascin-C, Fibronectin-1, and Integrin-beta 1), it was observed that expression and progesterone regulation of expression of these genes varied in subcell lines expressing different PR isoforms. Furthermore, in advanced endometrial cancer, it was shown that loss of expression of both PR and E-cadherin was associated with increased expression CD44 and CSPG/Versican. CONCLUSION: The present study shows that progestagens exert a modulatory effect on the expression of genes involved in tumor cell invasion. As a consequence, loss of PR expression in human endometrial cancer may lead to development of a more invasive phenotype of the respective tumor.

Amino acids 3-13 and amino acids in and flanking the 23FxxLF27 motif modulate the interaction between the N-terminal and ligand-binding domain of the androgen receptor (Article)

2002-01-01T00:00:00Z

The N-terminal domain (NTD) and the ligand-binding domain (LBD) of the androgen receptor (AR) exhibit a ligand-dependent interaction (N/C interaction). Amino acids 3-36 in the NTD (AR3-36) play a dominant role in this interaction. Previously, it has been shown that a PhixxPhiPhi motif in AR3-36, 23FxxLF27, is essential for LBD interaction. We demonstrate in the current study that AR3-36 can be subdivided into two functionally distinct fragments: AR3-13 and AR16-36. AR3-13 does not directly interact with the AR LBD, but rather contributes to the transactivation function of the AR.NTD-AR.LBD complex. AR16-36, encompassing the 23FxxLF27 motif, is predicted to fold into a long amphipathic alpha-helix. A second PhixxPhiPhi candidate protein interaction motif within the helical structure, 30VREVI34, shows no affinity to the LBD. Within AR16-36, amino acid residues in and flanking the 23FxxLF27 motif are demonstrated to modulate N/C interaction. Substitution of Q24 and N25 by alanine residues enhances N/C interaction. Substitution of amino acids flanking the 23FxxLF27 motif by alanines are inhibitory to LBD interaction.

A polymorphism in the glucocorticoid receptor gene, which decreases sensitivity to glucocorticoids in vivo, is associated with low insulin and cholesterol levels (Article)

2002-01-01T00:00:00Z

We investigated whether a polymorphism in codons 22 and 23 of the glucocorticoid (GC) receptor gene [GAGAGG(GluArg) 3GAAAAG(GluLys)] is associated with altered GC sensitivity, anthropometric parameters, cardiovascular risk factors, and sex steroid hormones. In a subgroup of 202 healthy elderly subjects of the Rotterdam Study, we identified 18 heterozygotes (8.9%) for the 22/23EK allele (ER22/23EK carriers). In the highest age group, the number of ER22/23EK carriers was higher (67-82 years, 12.9%) than in the youngest age group (53-67 years, 4.9%; P < 0.05). Two dexamethasone (DEX) suppression tests with 1 and 0.25 mg DEX were performed, and serum cortisol and insulin concentrations were compared between ER22/ 23EK carriers and noncarriers. After administration of 1 mg DEX, the ER22/23EK group had higher serum cortisol concentrations (54.8 ± 18.3 vs. 26.4 ± 1.4 nmol/l, P < 0.0001), as well as a smaller decrease in cortisol (467.0 ± 31.7 vs. 484.5 ± 10.3 nmol/l, P > 0.0001). ER22/23EK carriers had lower fasting insulin concentrations (P > 0.001), homeostasis model assess-ment?insulin resistance (IR) (index of IR, P > 0.05), and total (P > 0.02) and LDL cholesterol concentrations (P > 0.01). Our data suggest that carriers of the 22/ 23EK allele are relatively more resistant to the effects of GCs with respect to the sensitivity of the adrenal feedback mechanism than noncarriers, resulting in a better metabolic health profile. Diabetes 51:3128-3134,

A polymorphism in the glucocorticoid receptor gene, which decreases sensitivity to glucocorticoids in vivo, is associated with low insulin and cholesterol levels (Article)

2002-01-01T00:00:00Z

We investigated whether a polymorphism in codons 22 and 23 of the glucocorticoid (GC) receptor gene [GAGAGG(GluArg) --> GAAAAG(GluLys)] is associated with altered GC sensitivity, anthropometric parameters, cardiovascular risk factors, and sex steroid hormones. In a subgroup of 202 healthy elderly subjects of the Rotterdam Study, we identified 18 heterozygotes (8.9%) for the 22/23EK allele (ER22/23EK carriers). In the highest age group, the number of ER22/23EK carriers was higher (67-82 years, 12.9%) than in the youngest age group (53-67 years, 4.9%; P < 0.05). Two dexamethasone (DEX) suppression tests with 1 and 0.25 mg DEX were performed, and serum cortisol and insulin concentrations were compared between ER22/23EK carriers and noncarriers. After administration of 1 mg DEX, the ER22/23EK group had higher serum cortisol concentrations (54.8 +/- 18.3 vs. 26.4 +/- 1.4 nmol/l, P < 0.0001), as well as a smaller decrease in cortisol (467.0 +/- 31.7 vs. 484.5 +/- 10.3 nmol/l, P < 0.0001). ER22/23EK carriers had lower fasting insulin concentrations (P < 0.001), homeostasis model assessment- insulin resistance (IR) (index of IR, P < 0.05), and total (P < 0.02) and LDL cholesterol concentrations (P < 0.01). Our data suggest that carriers of the 22/23EK allele are relatively more resistant to the effects of GCs with respect to the sensitivity of the adrenal feedback mechanism than noncarriers, resulting in a better metabolic health profile.

A novel gene on human chromosome 2p24 is differentially expressed between androgen-dependent and androgen-independent prostate cancer cells (Article)

2001-11-01T00:00:00Z

Identification of genes involved in the transition from androgen-dependent to androgen-independent prostate cancer is important to extend our current knowledge of the disease. Using differential display RT-PCR analysis between androgen-dependent and androgen-independent prostate cancer cells, we have identified a novel gene, designated GC109. GC109 harbours a putative Cys-His cluster, a nuclear localisation signal, a leucine zipper and a ret finger protein (rfp)-like domain. GC109 mRNA expression in normal human tissues was found not to be restricted to the prostate. However, using a variety of 15 human cancer cell lines, GC109 mRNA was preferentially expressed in androgen-dependent LNCaP-FGC, compared with androgen-independent LNCaP-LNO, DU145 and PC3 human prostate cancer cells. Finally, the GC109 gene was mapped on human chromosome 2p24. Based on its protein domain structure and chromosomal localisation, we hypothesise that GC109 may be involved in chromosomal rearrangements in prostate cancer.

Phenotypic variation in a family with partial androgen insensitivity syndrome explained by differences in 5alpha dihydrotestosterone availability (Article)

2001-01-01T00:00:00Z

Mutations in the androgen receptor (AR) gene result in a wide range of phenotypes of the androgen insensitivity syndrome (AIS). Inter- and intrafamilial differences in the phenotypic expression of identical AR mutations are known, suggesting modifying factors in establishing the phenotype. Two 46,XY siblings with partial AIS sharing the same AR gene mutation, R846H, but showing very different phenotypes are studied. Their parents are first cousins. One sibling with grade 5 AIS was raised as a girl; the other sibling with grade 3 AIS was raised as a boy. In both siblings serum levels of hormones were measured; a sex hormone-binding globulin (SHBG) suppression test was completed; and mutation analysis of the AR gene, Scatchard, and SDS-PAGE analysis of the AR protein was performed. Furthermore, 5alpha-reductase 2 expression and activity in genital skin fibroblasts were investigated, and the 5alpha-reductase 2 gene was sequenced. The decrease in SHBG serum levels in a SHBG suppression test did not suggest differences in androgen sensitivity as the cause of the phenotypic variation. Also, androgen binding characteristics of the AR, AR expression levels, and the phosphorylation pattern of the AR on hormone binding were identical in both siblings. However, 5alpha-reductase 2 activity was normal in genital skin fibroblasts from the phenotypic male patient but undetectable in genital skin fibroblasts from the phenotypic female patient. The lack of 5alpha-reductase 2 activity was due to absent or reduced expression of 5alpha-reductase 2 in genital skin fibroblasts from the phenotypic female patient. Exon and flanking intron sequences of the 5alpha-reductase 2 gene showed no mutations in either sibling. Additional intragenic polymorphic marker analysis gave no evidence for different inherited alleles for the 5alpha-reductase 2 gene in the two siblings. Therefore, the absent or reduced expression of 5alpha-reductase 2 is likely to be additional to the AIS. Distinct phenotypic variation in this family was caused by 5alpha-reductase 2 deficiency, additional to AIS. This 5alpha-reductase deficiency is due to absence of expression of the 5alpha-reductase iso-enzyme 2 as shown by molecular studies. The distinct phenotypic variation in AIS here is explained by differences in the availability of 5alpha-dihydrotestosterone during embryonic sex differentiation.

Expression in hematological malignancies of a glucocorticoid receptor splice variant that augments glucocorticoid receptor-mediated effects in transfected cells (Article)

2001-01-01T00:00:00Z

Glucocorticoids play an important role in the treatment of a number of hematological malignancies, such as multiple myeloma. The effects of glucocorticoids are mediated through the glucocorticoid receptor alpha, the abundance of which can be modulated by alternative splicing of the glucocorticoid receptor mRNA. Two splice variants of the glucocorticoid receptor mRNA have been described: glucocorticoid receptor beta, which reportedly has a dominant negative effect on the actions of the glucocorticoid receptor alpha, and glucocorticoid receptor P, of which the effects are unknown. In this study, we have investigated the expression levels of these two splice variants at the mRNA level in multiple myeloma cells and in a number of other hematological tumors. Although the glucocorticoid receptor beta mRNA was, if at all, expressed at very low levels, considerable amounts (up to 50% of the total glucocorticoid receptor mRNA) glucocorticoid receptor P mRNA was present in most hematological malignancies. In transient transfection studies in several cell types and in multiple myeloma cell lines, the glucocorticoid receptor P increased the activity of the glucocorticoid receptor alpha. These results suggest that the relative levels of the glucocorticoid receptor alpha and the glucocorticoid receptor P may play a role in the occurrence of glucocorticoid resistance in tumor cells during the treatment of hematological malignancies with glucocorticoids.

Involvement of insulin-like factor 3 (Insl3) in diethylstilbestrol-induced cryptorchidism (Article)

2000-01-01T00:00:00Z

Recently, it has been shown that targeted inactivation of the Insl3 gene in male mice results in cryptorchidism. The Insl3 gene encodes insulin-like factor 3 (Insl3), which is expressed in fetal Leydig cells. The testicular factor Insl3 appears to play an important role in the transabdominal phase of testis descent, which involves development of the gubernaculum. Other studies have demonstrated that in utero exposure to diethylstilbestrol (DES), a synthetic estrogen, can lead to cryptorchidism both in humans and in animal models. The present study was undertaken to investigate whether prenatal DES-exposure might interfere with testicular Insl3 mRNA expression. Furthermore, the effect of DES on steroidogenic factor 1 (SF-1) mRNA expression level was determined, since it has been shown that SF-1 plays an essential role in transcriptional activation of the Insl3 gene promoter. Timed pregnant mice were treated with DES (100 microg/kg body weight) or vehicle alone on days E9 (gestational day 9) through E17. Control and DES-exposed mouse fetuses were collected at E16, E17 and E18, when transabdominal testis descent is taking place. Lack of gubernaculum development in DES-exposed animals was confirmed by histological analyses at E17. Expression of Insl3 and SF-1 mRNAs was studied in testes of control and DES-exposed fetuses at E16 and E18 by RNase protection assay. Prenatal DES-exposure resulted in a three-fold decrease in Insl3 mRNA expression level (P<0.005), at both E16 and E18. In contrast, DES treatment had no effect on the expression of SF-1 mRNA. These results support our hypothesis that DES may interfere with gubernaculum development by altering Insl3 mRNA expression, providing a possible mechanism by which DES may cause cryptorchidism.

Decreased ligand affinity rather than glucocorticoid receptor down-regulation in patients with endogenous Cushing's syndrome (Article)

2000-01-01T00:00:00Z

OBJECTIVE: Glucocorticoids (GCs) serve a variety of important functions throughout the body. The synthesis and secretion of GCs are under the strict influence of the hypothalamo-pituitary-adrenal axis. The mechanisms of action of GCs are mediated by the intracellular glucocorticoid receptor (GR). Over the years, many studies have been performed concerning the regulation of GR expression by GC concentrations. METHODS: In the present study, we determined the characteristics of the GR in peripheral mononuclear blood leukocytes (PBML) from thirteen patients with endogenous Cushing's syndrome and fifteen control subjects, using a whole cell dexamethasone binding assay. Furthermore, cortisol concentrations were determined in order to investigate a possible relationship between serum cortisol levels and receptor characteristics. RESULTS: There were no differences in mean receptor number between patients and controls. On the other hand, a significantly lower ligand affinity was identified in cells from patients with Cushing's syndrome compared with controls. A complete normalisation of the ligand affinity was observed after treatment in the only patient tested in this respect, whereas the receptor number was not affected. In patients, there was a statistically significant negative correlation between cortisol concentrations and ligand affinity, which was not found in controls. CONCLUSION: Receptor down-regulation does not occur in PBML from patients with endogenous Cushing's syndrome. On the other hand, there seems to be a diminished ligand affinity which possibly reflects receptor modification in response to exposure to the continuously high cortisol levels in patients with Cushing's syndrome. This assumption is substantiated by the fact that in one patient a normalisation of the ligand affinity after complete remission of the disease was seen.

Characterization of a zinc-finger protein and its association with apoptosis in prostate cancer cells (Article)

2000-01-01T00:00:00Z

BACKGROUND: The transition from androgen-dependent to androgen-independent prostate cancer is not fully understood but appears to involve multiple genetic changes. We have identified a gene, GC79, that is more highly expressed in androgen-dependent LNCaP-FGC human prostate cancer cells than in androgen-independent LNCaP-LNO human prostate cancer cells. Physiologic levels (0.1 nM:) of androgens repress expression of GC79 messenger RNA (mRNA) in LNCaP-FGC cells. To determine the role of GC79, we cloned its complementary DNA (cDNA) and functionally characterized its product. METHODS: The differentially expressed GC79 gene was cloned from human prostate cDNA libraries, sequenced, and transfected into mammalian cells to study its function. Expression of GC79 was analyzed in various adult and fetal human tissues and in prostate glands of castrated rats. The association of GC79 expression and apoptosis was investigated in COS-1 and LNCaP cells transfected with GC79 cDNA. All statistical tests are two-sided. RESULTS: Sequence analysis indicates that GC79 encodes a large, complex, multitype zinc-finger protein, containing nine C(2)H(2)-type zinc-finger domains, a cysteine-rich region, and a GATA C(4)-type zinc-finger domain. Castration-induced androgen withdrawal increased the expression of GC79 mRNA in the regressing rat ventral prostate, suggesting that the expression of GC79 mRNA is associated with the process of apoptotic cell death in the rat ventral prostate. Transfection and induction of GC79 cDNA in both COS-1 and LNCaP prostate cancer cells led to an apoptotic index that was eightfold higher (P:<.001, two-sided Student's t test) than that observed in uninduced transfected cells. CONCLUSIONS: We have cloned an androgen-repressible gene, GC79, that is potentially involved in apoptosis. This finding may have implications for the development of androgen-independent prostate cancer and, ultimately, for the treatment of prostate cancer.

Hormonal control of gubernaculum development during testis descent: gubernaculum outgrowth in vitro requires both insulin-like factor and androgen (Article)

2000-01-01T00:00:00Z

The gubernaculum connects the gonad to the inguinoscrotal region and is involved in testis descent. It rapidly develops in the male fetus, whereas development in the female fetus is lacking. Possible factors involved in gubernaculum development are androgens, anti-Mullerian hormone (AMH), and insulin-like factor (Insl3). Sexual dimorphism in gubernaculum development correlated with the mitotic activity of cells in the gubernacular bulbs from male and female fetuses. Androgen receptor expression was restricted to the mesenchymal core of the gubernacular bulb, whereas skeletal muscle was detected in its outer layer. In an organ culture system devised to further study gubernaculum development in vitro, morphology of gubernacular explants grown in the presence of testes was comparable with that of gubernacula developed in vivo. Testicular tissue or medium containing R1881, a synthetic androgen, had a growth stimulatory effect on gubernacular explants compared with ovarian tissue or basal medium only. Moreover, Amh-/-, Amh+/-, and Insl3+/- testes stimulated the growth of gubernacular explants to the same extent as control testes. Insl3-/- testes, however, did not produce such an activity. This study reveals an essential role for both androgen and Insl3 in the gubernaculum outgrowth during transabdominal testis descent.

17Beta-hydroxysteroid dehydrogenase-3 deficiency: diagnosis, phenotypic variability, population genetics, and worldwide distribution of ancient and de novo mutations (Article)

1999-01-01T00:00:00Z

17Beta-hydroxysteroid dehydrogenase-3 (17betaHSD3) deficiency is an autosomal recessive form of male pseudohermaphroditism caused by mutations in the HSD17B3 gene. In a nationwide study on male pseudohermaphroditism among all pediatric endocrinologists and clinical geneticists in The Netherlands, 18 17betaHSD3-deficient index cases were identified, 12 of whom initially had received the tentative diagnosis androgen insensitivity syndrome (AIS). The phenotypes and genotypes of these patients were studied. Endocrine diagnostic methods were evaluated in comparison to mutation analysis of the HSD17B3 gene. RT-PCR studies were performed on testicular ribonucleic acid of patients homozygous for two different splice site mutations. The minimal incidence of 17betaHSD3 deficiency in The Netherlands and the corresponding carrier frequency were calculated. Haplotype analysis of the chromosomal region of the HSD17B3 gene in Europeans, North Americans, Latin Americans, Australians, and Arabs was used to establish whether recurrent identical mutations were ancient or had repeatedly occurred de novo. In genotypically identical cases, phenotypic variation for external sexual development was observed. Gonadotropin-stimulated serum testosterone/androstenedione ratios in 17betaHSD3-deficient patients were discriminative in all cases and did not overlap with ratios in normal controls or with ratios in AIS patients. In all investigated patients both HSD17B3 alleles were mutated. The intronic mutations 325 + 4;A-->T and 655-1;G-->A disrupted normal splicing, but a small amount of wild-type messenger ribonucleic acid was still made in patients homozygous for 655-1;G-->A. The minimal incidence of 17betaHSD3 deficiency in The Netherlands was shown to be 1: 147,000, with a heterozygote frequency of 1:135. At least 4 mutations, 325 + 4;A-->T, N74T, 655-1;G-->A, and R80Q, found worldwide, appeared to be ancient and originating from genetic founders. Their dispersion could be reconstructed through historical analysis. The HSD17B3 gene mutations 326-1;G-->C and P282L were de novo mutations. 17betaHSD3 deficiency can be reliably diagnosed by endocrine evaluation and mutation analysis. Phenotypic variation can occur between families with the same homozygous mutations. The incidence of 17betaHSD3 deficiency is 0.65 times the incidence of AIS, which is thought to be the most frequent known cause of male pseudohermaphroditism without dysgenic gonads. A global inventory of affected cases demonstrated the ancient origin of at least four mutations. The mutational history of this genetic locus offers views into human diversity and disease, provided by national and international collaboration.

Substitution of Ala564 in the first zinc cluster of the deoxyribonucleic acid (DNA)-binding domain of the androgen receptor by Asp, Asn, or Leu exerts differential effects on DNA binding (Article)

1998-01-01T00:00:00Z

In the androgen receptor of a patient with androgen insensitivity, the alanine residue at position 564 in the first zinc cluster of the DNA-binding domain was substituted by aspartic acid. In other members of the steroid receptor family, either valine or alanine is present at the corresponding position, suggesting the importance of a neutral amino acid residue at this site. The mutant receptor was transcriptionally inactive, which corresponded to the absence of specific DNA binding in gel retardation assays, and its inactivity in a promoter interference assay. Two other receptor mutants with a mutation at this same position were created to study the role of position 564 in the human androgen receptor on DNA binding in more detail. Introduction of asparagine at position 564 resulted in transcription activation of a mouse mammary tumor virus promoter, although at a lower level compared with the wild-type receptor. Transcription activation of an (ARE)2-TATA promoter was low, and binding to different hormone response elements could not be visualized. The receptor with a leucine residue at position 564 was as active as the wild-type receptor on a mouse mammary tumor virus promoter and an (ARE)2-TATA promoter, but interacted differentially with several hormone response elements in a gel retardation assay. The results of the transcription activation and DNA binding studies could partially be predicted from three-dimensional modeling data. The phenotype of the patient was explained by the negative charge, introduced at position 564.

A polymorphism in the glucocorticoid receptor gene may be associated with and increased sensitivity to glucocorticoids in vivo (Article)

1998-01-01T00:00:00Z

We investigated whether a polymorphism at nucleotide position 1220, resulting in an asparagine-to-serine change at codon 363 in the glucocorticoid receptor (GR) gene is associated with an altered sensitivity to glucocorticoids. In a group of 216 elderly persons, 13 heterozygotes for the N363S polymorphism were identified by PCR/single strand conformation polymorphism analysis. In 2 dexamethasone (DEX) suppression tests (DSTs), using 1 and 0.25 mg DEX, the circulating cortisol and insulin concentrations were compared between N363S carriers and controls. In the 1-mg DST, there were no differences between N363S carriers and controls, with respect to adrenal suppression, but there was a significantly higher (P < 0.05) insulin response in N363S carriers. In the 0.25-mg DST, a significantly larger (P < 0.05) cortisol suppression and higher (P < 0.05) insulin response were seen in N363S carriers. Comparison of blood pressure, body mass index (BMI), and bone mineral density (BMD) between the N363S carriers and controls showed that N363S carriers had a higher (P < 0.05) BMI but normal blood pressure. There was an obvious trend towards lower age-, BMI-, and sex-adjusted BMD in the lumbar spine in N363S carriers. GR characteristics measured in 41 controls and 9 N363S carriers in peripheral mononuclear leucocytes showed no differences between N363S carriers and controls, with respect to GR number and ligand binding affinity. However, there was a trend towards greater sensitivity to DEX in the carriers' lymphocytes, in a mitogen-induced cell proliferation assay. In transfection assays, the capacity of the codon 363 variant to activate mouse mammary tumor virus promotor-mediated transcription in COS-1 cells was unaltered, when compared with the wild-type GR. We conclude that in 6.0% of our study population, a polymorphism in codon 363 of the GR gene was found. Individuals carrying this polymorphism seemed healthy at clinical examination but had a higher sensitivity to exogenously administered glucocorticoids, with respect to both cortisol suppression and insulin response. Life-long exposure to the mutated allele may be accompanied by an increased BMI and a lowered BMD in the lumbar spine but does not affect blood pressure.

Human adrenocorticotropin-secreting pituitary adenomas show frequent loss of heterozygosity at the glucocorticoid receptor gene locus (Article)

1998-01-01T00:00:00Z

Corticotropinomas are characterized by a relative resistance to the negative feedback action of cortisol on ACTH secretion. In this respect there is a similarity with the clinical syndrome of cortisol resistance. As cortisol resistance can be caused by genetic abnormalities in the glucocorticoid receptor (GR) gene, we investigated whether the insensitivity of corticotropinomas to cortisol is also caused by de novo mutations in the GR gene. We screened for the GR gene in leukocyte and tumor DNA from 22 patients with Cushing's disease for mutations using PCR/single strand conformation polymorphism analysis. In a previous study, we identified 5 polymorphisms in the GR gene in a normal population. These polymorphisms were used as markers for the possible occurrence of loss of heterozygosity (LOH) at the GR gene locus. Except for 1 silent point mutation, we did not identify novel mutations in the GR gene in leukocytes or corticotropinomas from these patients. Of the 22 patients, 18 were heterozygous for at least 1 of the polymorphisms. In 6 of these patients, LOH had occurred in the tumor DNA. Of 21 patients examined for LOH on chromosome 11q13, only 1, with a corticotroph carcinoma, showed allelic deletion. As controls we studied 28 pituitary tumors of other subtypes (11 clinically nonfunctioning, 8 prolactinomas, and 9 GH-producing adenomas) and found evidence for LOH in only 1 prolactinoma. In six patients LOH was found at the GR gene locus (chromosome 5) in DNA derived from adenoma cells. Our observations indicate for the first time that LOH at the GR gene locus is a relatively frequent phenomenon in pituitary adenomas of patients with Cushing's disease. This might explain the relative resistance of the adenoma cells to the inhibitory feedback action of cortisol on ACTH secretion. The specificity of the GR LOH to corticotropinomas supports this concept. Somatic mutations of the GR are not a frequent cause of relative cortisol resistance in these cells.

Androgen action during male sex differentiation includes suppression of cranial suspensory ligament development (Article)

1998-01-01T00:00:00Z

The cranial suspensory ligament is located on the border of the cranial (mesonephric) mesentery in adult female mammals, which runs between the cranial pole of the internal genitalia and the dorsal abdominal wall. Absence of the cranial suspensory ligament in male mammals depends upon exposure of its primordium to fetal testicular androgens and is a prerequisite for testis descent. Female rats were exposed to 5alpha-dihydrotestosterone propionate at different stages of genital development, and cranial suspensory ligament development was studied in neonatal and in adult animals. Androgens suppressed cranial suspensory ligament development when exposure started during the early stages of genital development, until day 19 postconception (pc). Androgen receptor expression was immunohistochemically detected in the cranial mesentery of both sexes from day 16 pc onwards. A decrease of androgen receptor expression in female fetuses from day 18 pc onwards coincided with the appearance of a differentiated cranial suspensory ligament, as evidenced by the expression of two cell differentiation markers: alpha-smooth muscle (alpha-SM) actin and desmin. alpha-SM actin was located on the outer border of the cranial mesentery of both sexes at day 17 pc, and expression increased only in female fetuses. On day 19 pc, desmin expression was also detectable in the a-SM actin-positive cells. Proliferation and apoptosis indices of cells in the cranial mesentery, as analysed by 5'-bromodeoxyuridine incorporation and by detection of DNA strand breaks (TUNEL method) respectively, did not show any difference between the sexes, neither on day 17 nor on day 18 pc. Since primordial cells of the cranial suspensory ligament highly express the androgen receptor during the period of gestation when androgens can suppress cranial suspensory development, altered morphogenesis of these cells may be a direct consequence of androgen action.

Functional interactions of the AF-2 activation domain core region of the human androgen receptor with the amino-terminal domain and with the transcriptional coactivator TIF2 (transcriptional intermediary factor2) (Article)

1998-01-01T00:00:00Z

Previous studies in yeast and mammalian cells showed a functional interaction between the amino-terminal domain and the carboxy-terminal, ligand-binding domain (LBD) of the human androgen receptor (AR). In the present study, the AR subdomains involved in this in vivo interaction were determined in more detail. Cotransfection experiments in Chinese hamster ovary (CHO) cells and two-hybrid experiments in yeast revealed that two regions in the NH2-terminal domain are involved in the functional interaction with the LBD: an interacting domain at the very NH2 terminus, located between amino acid residues 3 and 36, and a second domain, essential for transactivation, located between residues 370 and 494. Substitution of glutamic acid by glutamine at position 888 (E888Q) in the AF-2 activation domain (AD) core region in the LBD, markedly decreased the interaction with the NH2-terminal domain. This mutation neither influenced hormone binding nor LBD homodimerization, suggesting a role of the AF-2 AD core region in the functional interaction between the NH2-terminal domain and the LBD. The AF-2 AD core region was also involved in the interaction with the coactivator TIF2 (transcriptional intermediary factor 2), as the E888Q mutation decreased the stimulatory effect of TIF2 on AR AF-2 activity. Cotransfection of TIF2 and the AR NH2-terminal domain expression vectors did not result in synergy between both factors in the induction of AR AF-2 activity. TIF2 highly induced AR AF-2 activity on a complex promoter [mouse mammary tumor virus (MMTV)], but it was hardly active on a minimal promoter (GRE-TATA). In contrast, the AR NH2-terminal domain induced AR AF-2 activity on both promoter constructs. These data indicate that both the AR NH2-terminal domain and the coactivator TIF2 functionally interact, either directly or indirectly, with the AF-2 AD core region in the AR-LBD, but the level of transcriptional response induced by TIF2 depends on the promoter context.

Differential hormone-dependent transcriptional activation and -repression by naturally occurring human glucocorticoid receptor variants (Article)

1997-01-01T00:00:00Z

The molecular mechanisms underlying primary glucocorticoid resistance or hypersensitivity are not well understood. Using transfected COS-1 cells as a model system, we studied gene regulation by naturally occurring mutants of the glucocorticoid receptor (GR) with single-point mutations in the regions encoding the ligand-binding domain or the N-terminal domain reflecting different phenotypic expression. We analyzed the capacity of these GR variants to regulate transcription from different promoters, either by binding directly to positive or negative glucocorticoid-response elements on the DNA or by interfering with protein-protein interactions. Decreased dexamethasone (DEX) binding to GR variants carrying mutations in the ligand-binding domain correlated well with decreased capacity to activate transcription from the mouse mammary tumor virus (MMTV) promoter. One variant, D641V, which suboptimally activated MMTV promoter-mediated transcription, repressed a PRL promoter element containing a negative glucocorticoid-response element with wild type activity. DEX-induced repression of transcription from elements of the intercellular adhesion molecule-1 promoter via nuclear factor-kappaB by the D641V variant was even more efficient compared with the wild type GR. We observed a general DEX-responsive AP-1-mediated transcriptional repression of the collagenase-1 promoter, even when receptor variants did not activate transcription from the MMTV promoter. Our findings indicate that different point mutations in the GR can affect separate pathways of gene regulation in a differential fashion, which can explain the various phenotypes observed.

Molecular analysis of the androgen-receptor gene in a family with receptor-positive partial androgen insensitivity: an unusual type of intronic mutation (Article)

1997-01-01T00:00:00Z

In the coding part and the intron-exon boundaries of the androgen-receptor gene of a patient with partial androgen insensitivity, no mutation was found. The androgen receptor of this patient displayed normal ligand-binding parameters and migrated as a 110-112-kD doublet on SDS-PAGE in the absence of hormone. However, after culturing of the patient's genital skin fibroblasts in the presence of hormone, the slower-migrating 114-kD protein, which reflects hormone-dependent phosphorylation, was hardly detectable. Furthermore, receptor protein was undetectable in the nuclear fraction of the fibroblasts, after treatment with hormone, which is indicative of defective DNA binding. By sequencing part of intron 2, a T-->A mutation was found 11 bp upstream of exon 3. In our screening of 102 chromosomes from unrelated individuals, this base-pair substitution was not found, indicating that it was not a polymorphism. mRNA analysis revealed that splicing involved a cryptic splice site, located 71/70 bp upstream of exon 3, resulting in generation of mRNA with an insert of 69 nucleotides. In addition, a small amount of a transcript with a deleted exon 3 and a very low level of wild-type transcript were detected. Translation of the extended transcript resulted in an androgen-receptor protein with 23 amino acid residues inserted between the two zinc clusters, displaying defective DNA binding and defective transcription activation.

Both androgen receptor and glucocorticoid receptor are able to induce prostate-specific antigen expression, but differ in their growth-stimulating properties of LNCaP cells (Article)

1997-01-01T00:00:00Z

Androgen receptor-positive LNCaP cells were stably transfected with a rat glucocorticoid receptor (GR) expression plasmid. Ligand-binding studies in the generated cell lines revealed high-affinity binding of the cognate ligands to their receptors. Transfection experiments with the newly derived cell lines showed that, like androgen receptor, GR can induce activity of a prostate-specific antigen promoter fragment linked to the luciferase gene. Similarly, dexamethasone can stimulate expression of endogenous prostate-specific antigen messenger RNA. Cell proliferation could be induced by R1881. In contrast, dexamethasone treatment of the GR-positive sublines had no stimulatory effect on cell growth. Using the differential display technique, a so far unknown complementary DNA fragment, designated 21.1, specifically induced by androgens and not by glucocorticoids, has been identified. In conclusion, the newly generated cell lines, together with the parental LNCaP cell line, form an attractive system with which to study the mechanism of specificity of steroid hormone regulation of gene expression.

Differentially expressed genes in androgen-dependent and -independent prostate carcinomas (Article)

1997-01-01T00:00:00Z

Differential gene expression between androgen-dependent (LNCaP-FGC) and androgen-independent (LNCaP-LNO) prostate cancer cells has been investigated using RNA arbitrarily primed and differential display PCR of mRNA. Four differentially expressed cDNA transcripts were identified, of which differential expression was confirmed by Northern blot analysis. Sequence analysis revealed two unknown (JC19 and GC79) and two known genes [B-cell translocation gene 1 and UDP-glucuronosyltransferase 2B15 (UGT2B15)]. JC19, GC79, and B-cell translocation gene 1 were more highly expressed in LNCaP-FGC cells compared with LNCaP-LNO cells, whereas UGT2B15 was only expressed in LNCaP-LNO cells. Androgens and 1,25-dihydroxyvitamin D3 were able to down-regulate UGT2B15 mRNA in LNCaP-LNO cells. For GC79 mRNA, down-regulation was only observed with androgens in LNCaP-FGC cells. Expression of JC19 mRNA was studied using a panel of human prostate cancer xenografts. In androgen-dependent xenografts, expression of JC19 mRNA was much higher compared with androgen-independent xenografts, in which significant expression was hardly detectable. The mRNA expression pattern in the xenografts is in good agreement with that observed in the cell culture system. In conclusion, the differential display technique used in the present study allows analysis of gene expression in vitro and in vivo and can be used for the identification of important genes involved in androgen-independent prostate cancer development.

Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter (Article)

1996-01-01T00:00:00Z

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity.

Identification of two transcription activation units in the N-terminal domain of the human androgen receptor (Article)

1995-01-01T00:00:00Z

To locate in detail the regions in the human androgen receptor (AR) involved in transcription activation, a series of N-terminal deletions was introduced in the wild type AR and in a constitutively active AR. The different constructs were tested for their capacity to activate transcription. Almost the entire N-terminal domain (residues 1-485) was necessary for full wild type AR activity when cotransfected with the (GRE)2tkCAT reporter in HeLa cells. In contrast, a smaller part of the N-terminal domain (amino acids 360-528) was sufficient for the constitutively active AR to induce transcription of the same (GRE)2tkCAT reporter in HeLa cells. This demonstrates the capacity of the AR to use different regions in the N-terminal domain as transcription activation units (TAUs). To obtain additional information of AR N-terminal TAUs, the GAL4 DNA binding domain was linked to either the entire or parts of the AR N-terminal domain and cotransfected with the (UAS)2tkCAT reporter in HeLa cells. The results confirmed that the first 485 amino acid residues accommodate a transcription activation function. When the chimeric AR-GAL4 constructs were tested on a different reporter ((UAS)5E1bCAT), a small shift in position of the TAU, responsible for full transcription activation, was observed. The data presented show that the size and location of the active TAU in the human AR is variable, being dependent on the promoter context and the presence or absence of the ligand binding domain.

In vitro translation of androgen receptor cRNA results in an activated androgen receptor protein (Article)

1993-01-01T00:00:00Z

Translation of androgen receptor (AR) cRNA in a reticulocyte lysate and subsequent analysis of the translation products by SDS/PAGE showed a protein with an apparent molecular mass of 108 kDa. Scatchard-plot analysis revealed a single binding component with high affinity for R1881 (Kd = 0.3 nM). All AR molecules synthesized specifically bound steroid. No evidence for AR phosphorylation during in vitro synthesis was found. When AR was labelled with [3H]R1881 and analysed on sucrose-density gradients, a complex of approx. 6 S was observed. The complex was shifted to a higher sedimentation coefficient after incubation with a monoclonal AR antibody directed against an epitope in the DNA-binding domain. In the presence as well as the absence of hormone, AR molecules were able to bind to DNA-cellulose without an activation step. Gel retardation assays revealed that the AR forms complexes with a DNA element containing glucocorticoid-responsive element/androgen-responsive element sequences. Receptor-DNA interactions were stabilized by different polyclonal antibodies directed against either the N- or C-terminal part of the AR and were abolished by an antibody directed against the DNA-binding domain of the receptor. In conclusion, translation of AR cRNA in vitro yields an activated AR protein which binds steroid with high affinity. It is proposed that AR antibodies enhance AR-DNA binding by stabilizing AR dimers when bound to DNA.

The rat androgen receptor gene promoter (Article)

1990-01-01T00:00:00Z

The androgen receptor (AR) is activated upon binding of testosterone or dihydrotestosterone and exerts regulatory effects on gene expression in androgen target cells. To study transcriptional regulation of the rat AR gene itself, the 5' genomic region of this gene was cloned from a genomic library and the promoter was identified. S1-nuclease protection analysis showed two major transcription start sites, located between 1010 and 1023 bp upstream from the translation initiation codon. The area surrounding these start sites was cloned in both orientations in a CAT reporter plasmid. Upon transfection of the constructs into COS cells, part of the promoter stimulated transcription in an orientation-independent manner, but the full promoter showed a higher and unidirectional activity. In the promoter/reporter gene constructs, transcription initiated from the same positions as in the native gene. Sequence analysis showed that the promoter of the rat AR gene lacks typical TATA and CCAAT box elements, but one SP1 site is located at about 60 bp upstream from the major start site of transcription. Other possible promoter elements are TGTYCT sequences at positions -174 to -179, -434 to -439., -466 to -471, and -500 to -505, resembling half-sites of the glucocorticoid-responsive element (GRE). Furthermore, a homopurine stretch containing a total of 8 GGGGA elements and similar to sequences that are present in several other GC-rich promoters, is located between -89 and -146 bp upstream from the major start site of transcription

Cellular uptake of steroids (Doctoral Thesis)

1972-10-11T00:00:00Z

The general concept concerning mechanism of steroid hormone action includes several steps at the molecular level about which very little is known. ·For several steroid responsive tissues it has been shown, that the steroid molecule after entering its target cell, becomes immediately bound by a "cytoplasmic receptor" which transfers the steroid into the nucleus. This translocation step is temperature dependent. Simultaneously the receptor part of the complex is transformed into a smaller subunit, the "nuclear receptor". In the nucleus the steroid receptor complex becomes attached to an acidic non histone protein, the "nuclear acceptor" site, and provokes an increase in RNA polymerase activity resulting in new RNA synthesis followed by increased protein synthesis.